Menu

Trylogia o bielcach - biologia termitów 1/3

Oto opowieść o imperium, jego potędze i dominacji. O dojściu do władzy, panowaniu potężnej władczyni. Ogromne armie wyruszają na podbój podporządkowując sobie lokalne środowisko. Wielkie mocarstwa powstają w wyniku prania mózgów. Na bezlitosnym podporządkowaniu społeczności owadów, kaście reproduktorów i kapłanów. Kacper Jerzy Piwowarek i Radio Warroza prezentują: Trylogię o bielcach - część pierwsza: Biologia termitów.

Kacper: członek zespołu badawczego prof. Ewy Joanny Godzińskiej w Pracowni Etologii w Instytucie Biologii Doświadczalnej im. M. Nenckiego PAN, gdzie m.in. bada zachowania i możliwości poznawcze owadów. Jego specjalnością są karaczany.

Zdjęcie na okładkę: budak

Rozdziały:

  • 00:00:00 Intro

  • 00:01:24 Rodowód termitów

  • 00:15:10 Termity niższe

  • 00:21:32 Cykl życia bielca

  • 00:40:40 Termity wyższe

  • 00:56:00 Wojny i niewolnictwo

Produkcja podkastu wymaga dużego nakładu pracy. Jeżeli spodobał się Tobie odcinek możesz postawić mi dobrą kawę lub coś innego: https://tiny.pl/78v2j
Możesz także regularnie wspierać Radio Warroza za pomocą portalu Patronite:
Darowizna przez BTC: 1KE9dLUgrjBuKz45Tpt2jFyehiAxGmwgrt

Kasty termitów z rodzaju Macrotermes

Przodem: żołnierz lub żołnierka, tyłem: robotnicy lub robotnice
Przodem: żołnierz lub żołnierka, tyłem: robotnicy lub robotnice, fot: Bernard DuPont
Młoda księżniczka - matka NU, fot: Bernard DuPont
Książe po utracie skrzydeł, kopulacje pary królewskiej odbywają się dopiero w komnacie
Książe po utracie skrzydeł, kopulacje pary królewskiej odbywają się dopiero w komnacie, fot: Bernard DuPont
Para królewska i świeże jajka, matka UN

Pszczele Wieści

Kto wie ten wie, a kto nie wie to się dowie, ale Warroza uczestniczy też w realizacji drugiego podkastu o nazwie: Pszczele Wieści. W zeszłym roku brała udział w nagraniach pierwszej serii edukacyjnej bardziej dla ludzi zainteresowanych biologią pszczół i pszczelarstwem na poziomie nieco więcej niż podstawowym.

Tym razem wpadła na pomysł, aby w drugim sezonie Pszczelich Wieści spotykało się trzech różnych pszczelarzy

(Tom, Emil i Warroza),

którzy na luźno będą sobie rozmawiali na temat bieżących publikacji w prasie pszczelarskiej i nauce pszczelnictwa. Postaramy się pokazać różne sposoby podejścia do pszczelarstwa, mając na uwadze nasze różne doświadczenia: od typowego hobbysty po zawodowca. Będzie to taka

produktywna prasówka - merytoryczna dyskusja,

ale być może pojawiają się także zupełnie luźne rozmowy i dopracowane sprawozdania. Pożyjemy posłuchamy.

Poza powyższymi celami ma to też być dla Warrozy taka odskocznia typowo pszczelarska, której główny podkast Radio Warroza wraz z rozwojem zainteresowań i ciekawością świata oraz pasją popularyzowania wiedzy, wykracza już w tej chwili dość znacznie poza samo pszczelarstwo, a nawet pszczelnictwo. To nie znaczy, że gośćmi Radio Warroza nie będą znów interesujący zróżnicowani pszczelarze i specjaliści nauk pszczelnictwa lub nauk pokrewnych. Jak najbardziej są tacy w planach, choć cały zakres poruszanych tematów można podejrzewać, że wyjdzie nawet poza entomologię i ekologię ewolucyjną, a będzie czasem także zahaczał dość mocno o filozofię przyrody. W najbliższych planach jest odcinek o ochronie zapylaczy w Polsce oraz trylogia dotyczący biologii bielcy (termitów). Resztę sekretnych planów Warrozy nie zdradza, bo za chwilę wygada wszystko szczękoczułami, a przecież trzeba zostawić nieco więcej przepowiedni dla Patronów.

Bez zbędnego rozwodzenia się Warroza zaprasza na drugą serię #PszczeleWieści w imieniu swoim, Toma i Emila.

Wyprodukowaliśmy już zwiastun oraz pierwszy odcinek:

Goń nas do pracy. Wstrzyknij nieco hemolimfy. Jeżeli spodobał się Tobie odcinek możesz postawić nam dobrą kawę lub coś innego: https://tiny.pl/78v2j
Możesz także regularnie wspierać Pszczele Wieści za pomocą portalu Patronite:
Darowizna przez BTC: 1KE9dLUgrjBuKz45Tpt2jFyehiAxGmwgrt
Możesz kupić gadżety w sklepiku Warrozy: http://warroza.cupsell.pl/
Baner sklepiku Warrozy

Bez żadnych pieniędzy możesz też wspierać Pszczele Wieści po prostu udostępniając odcinek w mediach społecznościowych znajomym i na grupach (młodzieżowo pisząc, możesz zaszerować kontentem). Możesz też wysłać linka znajomym, których może to zainteresować. Możesz wstawić link na swojej stronie. Nic Cię to nie kosztuje, a Warrozie oszczędza mnóstwo pracy, który może poświęcić na produkcję kolejnych odcinków

Plakat poskastu #PszczeleWieści

Pszczelarska chemia i pestycydy

Wszystko jest trucizną i nic nie jest trucizną: tylko od dawki zależy czy coś jest szkodliwe. Ta myśl Paracelsusa najlepiej oddaje istotę rzeczy. Czy zatem naturalne zawsze oznacza zdrowsze? Czy jest synonimem dobrego? Spróbujmy uporządkować pojęcia związane z pestycydami stosowanymi także w pszczelarstwie.

Artykuł ten jest pełną wersją skróconego i nieco przeformatowanego artykułu zamieszczonego w styczniowym numerze Pszczelarstwa 2021 r. pt: "Naturalne a sztuczne - dobre a złe". Dziękuję Pani dr Monice Mętrak za pomoc w napisaniu, poświęcony czas i wartościowe uwagi. Dziękuję również redaktorom czytającym i wnoszącym uwagi.

Infografika pestycydów pszczelarskich

W popularnym obiegu informacji występują głównie dwa znaczenia słowa „chemia”. Ze starogreckiego dosłownie tłumacząc to: rozpuszczanie. Współcześnie termin ten oznacza naukę przyrodniczą, która w dużym skrócie zajmuje się naturą właściwości substancji chemicznych i ich przemian. To znaczenie określiłbym jako fachowe i rzetelne.

Wiadomo że wszechświat składa się z bardziej lub mniej złożonych substancji chemicznych,

które z punktu widzenia teoretycznej fizyki i chemii kwantowej stanowią strukturę cząstek i energii, pozostających ze sobą we wzajemnych relacjach. Na potrzeby tych rozważań przyjmijmy, że substancje chemiczne składają się z pierwiastków chemicznych znanych z tablicy Mendelejewa. Jeżeli substancję tworzą co najmniej dwa różne pierwiastki, mamy do czynienia z substancją złożoną, inaczej związkiem chemicznym.

Chemia to my

Specyficznymi substancjami chemicznymi są związki organiczne, w których głównym szkieletem cząsteczki są łańcuchy czterowartościowych atomów węgla. Kiedyś sądzono, że substancje organiczne są wytwarzane tylko przez organizmy żywe. Wierzono w nieco abstrakcyjną „siłę życiową”, która ma zdolność do tworzenia takich wyjątkowych związków. Dziś już wiemy, że to nieprawda. Już w 1828 roku Friedrich Wöhler otrzymał organiczny kwas szczawiowy z reakcji nieorganicznych substratów: cyjanu w wodzie amoniakalnej. Następnie 4 lata później  otrzymał mocznik – nie z moczu końskiego – a poprzez ogrzewanie mieszaniny kwasu cyjanowego i wody amoniakalnej.

Inforgrafika prezentująca toksycznośc pszczelarskich pestycydów

Aktualnie drogą syntezy chemicznej poza organizmem żywym potrafimy otrzymać niemal wszystkie odkryte związki organiczne, produkowane przez organizmy żywe, a nawet opracowaliśmy szereg nowych. Zaobserwowaliśmy także, że proste związki organiczne mogą w określonych warunkach powstawać samoistnie z substancji nieorganicznych.

Poza Ziemią, np. w gwiazdach, planetach czy ich satelitach, odkryto również istnienie związków organicznych nie powiązanych z istnieniem życia pozaziemskiego. Zresztą, najbardziej popularną teorią naukową dotyczącą powstania życia (abiogenezy) jest ta, w której życie powstało na drodze fizykochemicznej z prostszych – niż te w komórce bakterii – substancji chemicznych, które w pewnym momencie uzyskały właściwości dziedziczenia swoich cech. To ostatnie umożliwiło rozpoczęcie procesu mechanizmu selekcji naturalnej na poziomie molekularnym (Weiner, 2006).

Syntetyczne nie zawsze znaczy sztuczne

Tradycja wydzielania związków organicznych jako specyficznych pozostała jednak do dziś. Przykładem substancji organicznej jest tymol, kwas mrówkowy i amitraza. W tym miejscu warto wyjaśnić jeszcze jedną nieścisłość. Amitraza to substancja zsyntetyzowana po raz pierwszy w 1969 roku przez firmę Boots Co. w Wielkiej Brytanii. Do momentu pierwszej syntezy amitraza nie występowała w środowisku, wobec tego nazywamy ją substancja sztuczną. Z kolei dobrze znany alkohol etylowy, jako substancja naturalna produkowana przez drożdże w procesie fermentacji, może być również wytwarzany w laboratorium lub fabryce na drodze hydrolizy lub gazyfikacji celulozy, a więc bez udziału drożdży. Produkt tych reakcji ma swój naturalny odpowiednik występujący w środowisku, dlatego nazywamy go substancją syntetyczną identyczną z naturalną. Wszystkie związki wytwarzane na drodze przemysłowej syntezy chemicznej, zarówno te mające naturalne odpowiedniki w środowisku, jak i te całkowicie sztuczne, nazywamy substancjami syntetycznymi (Danikiewicz, 1995). Zatem używany w pszczelarstwie kwas mrówkowy, szczawiowy, mlekowy oraz tymol są syntetycznymi odpowiednikami substancji naturalnych. Kolokwialnie można by powiedzieć, że są syntetyczną „chemią”.

Tymol i kwas mlekowy to syntetyczna "chemia" 

To pojęcie kojarzy nam się z czymś szkodliwym, powstałym w sposób sztuczny, jako przeciwieństwo czegoś „naturalnego”, wytworzonego albo przez organizm żywy, albo samoistnie bez udziału człowieka. Skojarzenie ma najczęściej charakter intuicyjny i emocjonalny. Myśl, że to, co naturalne jest dobre i pożyteczne, a to, co nienaturalne – złe i szkodliwe pojawia się niejako bezwiednie. Główna logika tej argumentacji przebiega tak: to co naturalne jest dobre i pożyteczne, a to co nienaturalne jest złe i szkodliwe. Jest to tak zwane odwołanie się do natury, czyli błąd z punktu widzenia logiki argumentacji merytorycznej, retoryczna zagrywka.

A przecież wszystko jest chemią, my też…

Dlatego przy racjonalnym podejściu do zagadnienia możemy jednak dojść do wniosku, że utożsamianie „chemii” z substancjami sztucznymi jest uproszczeniem, zakłamywaniem rzeczywistości. Znamy przecież wiele przykładów substancji sztucznych, które są mniej szkodliwe od naturalnych.

Infografika prezentująca dawki terapeutyczne - czynne leków pszczelarskich
Dawkę tymolu naukowcy wzięli podwójną z dwóch dawek, które podaje się po sobie. Wydaje się, że jest to niedociągnięcie badania. Kontaktowałem się na podany mejl w publikacji w tej sprawie, ale bez rezultatu. Jednak dawka kwasu mrówkowego jest podana prawidłowa.

Ewentualne różnice w działaniu pomiędzy substancją syntetyczną a surowcem naturalnym, który zawiera jej identyczny odpowiednik, mogą wynikać z różnic w zmiennym stężeniu tej substancji w organizmach, która może zależeć od warunków ich rozwoju. W tkance biologicznej i ogólnie w naturze występują także inne substancje, które mogą modyfikować działanie interesującej nas substancji. Kolejne różnice mogą wynikać z tego, że podczas ekstrakcji z surowca naturalnego powstają pochodne tej substancji, o nieco innych właściwościach fizycznych i chemicznych. Jednak sam syntetyczny kwas szczawiowy lub jego naturalny odpowiednik w liściu rabarbaru jest identyczny. Aby przedstawić rzetelne argumenty na korzyść naturalności, trzeba więc najpierw wykazać doświadczalnie, że to co naturalne jest korzystne, a to co sztuczne szkodliwe.

Najmocniejsze trucizny są także naturalne

Wiele z aktualnie poznanych najmocniejszych trucizn chemicznych na świecie jest pochodzenia naturalnego. Przy czym należy zauważyć, że czy coś jest trucizną, lekarstwem, czy też może być neutralne, zależy od dawki – nawet mocna trucizna może być lekarstwem w odpowiednio małej ilości. Aby to ustalić, bada się oddziaływanie różnych substancji chemicznych za pomocą obiektywnych metod toksykologicznych. Podstawowym kryterium jest tu LD50, co oznacza dawkę śmiertelną (letalną), w której ginie połowa osobników biorących udział w badaniu. Są też inne kryteria, jak LC50, które oznacza stężenie, co jest bardziej użyteczne np. przy badaniu gazów. DM, czyli dawka progowa, pozwala natomiast zaobserwować pierwsze dostrzegalne zmiany w organizmie. NOAEL ((ang. no-observed-adverse-effect level), oznacza najwyższy poziom substancji, który jeszcze nie wywołuje, dających się zaobserwować, niekorzystnych skutków.

Infografika prezentująca współczynnik zagrożenia dla pszczół

Dawka szkodliwa jest zależna od masy ciała organizmu, któremu podajemy substancję czynną (dlatego prawidłowo podaje się ja w przeliczeniu na kg masy ciała), oraz od specyfiki jego fizjologii. Im bardziej odmienne od siebie organizmy np. człowiek i pszczoła, tym bardziej odmienne i specyficzne efekty zastosowania tej samej substancji czynnej. Na przykład pestycydy takie jak kontrowersyjne neonikotynoidy lub pospolita dla nas kofeina mają znacznie niższe dawki letalne dla pszczół niż dla człowieka, a to oznacza, że pszczoły są na nie dużo bardziej wrażliwe. Oczywiście, po uwzględnieniu proporcji dawki do masy ciała, jakże różnego w tym wypadku.

Bierze się też pod uwagę dawki czynne, na jakie narażone są organizmy. W przypadku leku zwalczającego dręcza pszczelego (Varroa destructor) istotna jest dawka, która skutecznie likwiduje roztocza. Kwas mrówkowy, choć uznawany za środek „ekologiczny” i „organiczny”, choć jest mniej toksyczny dla pszczół, to musi być stosowany w stężeniach większych niż amitraza (Gashout, Goodwin i Guzman-Novoa, 2018). Z tego powodu ryzyko zgonu dla pojedynczej pszczoły w przypadku stosowania kwasu mrówkowego w dawkach terapeutycznych może być większe niż amitrazy. Generalnie jednak związki te są kwalifikowane jako relatywnie mało toksyczne dla pszczół, w przeciwieństwie np. do neonikotynoidów (Sanchez-Bayo, Goka, 2016).

Pszczelarskie pestycydy

W ten sposób płynnie przeszliśmy do pojęcia pestycydów. Czym one są? Z łacińskiego słowo to oznacza „zabijanie szkodników/likwidowanie zarazy”. Otóż są to preparaty i substancje używane do zwalczania organizmów uznanych za szkodliwe. Jest to najprostsza definicja. Można ją uszczegółowić, zaznaczając, że w ich skład mogą wchodzić substancje naturalne i syntetyczne, a także preparaty biologiczne, jak np. pewne mikroorganizmy. Nie spotkałem jednak żadnej definicji poważnej organizacji zajmującej się kontrolą i bezpieczeństwem żywności lub naukowej organizacji rolniczej, która wyłączałaby z nazwy pestycydów sformułowania: pewne związki organiczne, substancje naturalne lub preparaty biologiczne.

Środki "ekologiczne" przeciw warrozie to pestycydy

Zatem popularny pszczelarski podział środków zwalczających dręcza pszczelego na pestycydy oraz niepestycydy jest podziałem fałszywym. Kwasy, tymol i inne olejki eteryczne, jeżeli wprowadzane są do ula z intencją zwalczania jednego organizmu (dręcza) by leczyć drugi (rodzinę pszczelą), bez żadnej wątpliwości są pestycydami – a ściślej ujmując akarycydami – które zwalczają roztocza. Można je nazwać pestycydami naturalnymi. Podobnie ma się rzecz w przypadku środków ochrony roślin, które zabijają chwasty (herbicydy) i niepożądane owady (insektycydy), a jednocześnie leczą dane rośliny z chorób. Leki, które zwalczają choroby bakteryjne u ludzi i ratują miliony osób każdego dnia, też są pestycydami, a ściślej bakteriocydami. Wśród nich są np. antybiotyki, chemioterapeutyki, środki antyseptyczne lub leki przyszłości: preparaty z bakteriofagów.

Infografika prezentująca synergię działania pestycydów

Przykład nieracjonalnego podziału pestycydów pod kątem "tzw. lekkiej i twardej chemii" w pszczelarstwie nie jest oczywiście odosobniony.
Posługuje się nim popularny ruch rolnictwa „organicznego” i „biodynamicznego”. Organizacje „organiczne” nie proponują oczywiście całkowitego wykluczenia pestycydów z użycia, ponieważ generalnie nie da się produkować w sposób opłacalny żywności na większą skalę bez użycia pestycydów lub biotechnologii. Wynika to bowiem z samych mechanizmów ekologiczno-ewolucyjnych. Organizacje te dopuszczają więc użycie pestycydów i technik uznanych przez siebie za „naturalne” i „organiczne”, a nie dopuszczają uznanych przez siebie za sztuczne lub „syntetyczne”. Pierwsze mają być z założenia mniej szkodliwe niż drugie. Sęk w tym, że tak jak pisałem wyżej podział ten jest bardziej oparty na emocjach i ideologii, niż na racjonalnym rozumowaniu.

Po pierwsze samo słowo „substancje organiczne” nie oznacza tu fachowo rozumianych substancji organicznych i niesyntetycznych. Podział ten opiera się na zdyskredytowanych w pierwszej połowie XIX wieku poglądach o „siłach witalnych”, które mają powodować, że organizmy żywe produkują unikatowo działające substancje chemiczne, zwane „organicznymi”. W rzeczywistości za „organiczne” według tych organizacji uznaje się jednak pestycydy identyczne z występującymi naturalnie (jak np. syntetycznie produkowany kwas mrówkowy, tymol, pyretryna i pyretroidy), a nawet substancje nieorganiczne (jak np. preparaty z siarczanu lub tlenochlorku miedzi). Przy tym zapomina się, że generalnie użycie pestycydów nie jest niczym innym jak naśladowaniem przyrody.

Wszystkie nowo opracowane pestycydy są próbą udoskonalania działania substancji obecnych naturalnie

w organizmach żywych i służącym im m.in. do obrony przed patogenami, odstraszania konsumentów oraz w celu zwiększenia zdolności konkurencyjnych względem innych roślin (allelopatia).

Przykładem pszczelarskim jest np. syntetyczny fluwalinat, który należy do pyretroidów. Substancje te odkryto m.in. w chryzantemach, po czym udoskonalano przez syntezę związków pochodnych. Inny przykład to nikotyna, która była pierwowzorem neonikotynoidów – jeszcze kilkadziesiąt lat temu była masowo stosowanym pestycydem w formie ekstraktu z tytoniu. Używana była też kiedyś w pszczelarstwie. Współcześnie w krajach rozwiniętych jest niedozwolona na rynku pestycydów z powodu dużej toksyczności i małej selektywności. Na stronach internetowych promujących ekstensywne ogrodnictwo „organiczne” i „biodynamiczne” bez problemu można jednak znaleźć przepisy na naturalne preparaty z wywaru lub dymu tytoniu wykonane domowymi sposobami.

Jak pisałem wyżej, o tym czy coś jest mniej szkodliwe nie decyduje jednak naturalne pochodzenie ani skala produkcji, tylko obiektywne toksykologiczne kryteria wynikające z badań. Zresztą w tym ostatnim przypadku fachowa wiedza chemiczna nie potwierdza wiary w mniejszą szkodliwość substancji naturalnej. Nikotyna dla ssaków jest średnio dużo bardziej toksyczna niż syntetyczne pochodne (neonikotynoidy). Choć te ostatnie są niestety wciąż mocno toksyczne dla naszych pszczół (Sanchez-Bayo, Goka, 2016).

Natura pełna pestycydów

Zdjęcie liściołaza podobnego do żaby, który wydziela jedną z najmocniejszych trucizm znanych nauce.
Liściołaz żółty (Phyllobates terribilis): jego skóra, szczególnie w chwili stresu, wytwarza naturalny alkaloid: batrachotoksynę. 1 mg tej substancji na skórze liściołaza może zabić 10-20 osób. fot: Brian Gratwicke – CC BY

Rolnictwo „organiczne” i „ekologiczne” dopuszcza też biopestycydy np. bakterie Bacillus thuringiensis (w skrócie Bt) produkujące toksynę, która może zabijać pewne szkodliwe owady. Ma ona szereg zalet jak selektywność i wysoka skuteczność, które utrudniają pojawienie się na nią oporności. W pszczelarstwie na polskim rynku dostępny jest preparat B401 stosowany przeciwko motylowi barciakowi (Achroia grisella i Galleria mellonella). Jak podaje producent, jest to skoncentrowany roztwór bakterii Bt. Mogą go stosować tzw. „ekologiczne” pasieki. Preparaty z bakterii Bt uważane są za przyjazne dla środowiska naturalnego, choć ruch rolnictwa „organicznego” i „biodynamicznego” jest kategorycznie przeciwny wprowadzaniu do rolnictwa wszelkich organizmów zmodyfikowanych genetycznie precyzyjnymi metodami inżynieryjnymi (tzw. GMO). W tym m.in. takich roślin, które posiadają dodany gen z bakterii Bt, odpowiadający za produkcję tej toksyny. Rośliny te są dobrze przebadane.

Bezpieczne genetycznie zmodyfikowane rośliny

Zdecydowana większość badań poważnych instytucji naukowych potwierdza bezpieczeństwo w ich stosowaniu. Nie wykazują większej szkodliwości niż środki konwencjonalne, w tym użycie samych bakterii. Dużą jednak zaletą jest to, że taka roślina Bt jest w stanie bronić się sama, a substancja produkowana przez bakterie i roślinę jest chemicznie identyczna. Argumenty ruchów „organicznych” są jednak głównie ideologiczne. W dużym skrócie wskazują, że taka zmieniona genetycznie roślina jest nienaturalna, gdyż proces inżynierii genetycznej jest przeciwny „naturze”, a wszystko co nienaturalne jest dogmatycznie niekorzystne. Zapominają tylko, że ponad 90% pożywienia, które spożywamy jest produkowane przez organizmy genetycznie zmienione przez człowieka, tylko innymi technikami – najczęściej mniej precyzyjnymi i nie tak dobrze przebadanymi

Większość pożywienia człowieka jest zmodyfikowana genetycznie

Właśnie dążenie do większej selektywności (aczkolwiek daleko nam do ideału), czasu rozkładu substancji czynnej i skuteczności (czyli np. możliwości stosowania mniejszych dawek), a także precyzji w kontrolowaniu zanieczyszczeń w żywności, jest utożsamiane jako postęp w rozwoju nowoczesnych pestycydów. Kiedyś naukowcy spróbowali policzyć jaki procent naturalnych pestycydów produkowanych przez same rośliny, grzyby i zwierzęta, jest konsumowany przez ludzi. Wyszło, że takich naturalnych substancji obronnych, obecnych w żywności spożywamy ponad 99,99% w stosunku do pestycydów dodanych przez człowieka (Ames, Profest i Gold, 1990). Wprawdzie badanie to opublikowano w 1990 roku, ale nie sądzę, aby tak duża dysproporcja zmieniła się drastycznie od tego czasu.

Zdecydowana większośc pestycydów w żywności pochodzi z natury

Migdały zawierające naturalną mocną truciznę
Gorzka odmiana migdałów (Prunus dulcis) zawierająca naturalne glikozydy cyjanogenne, używana jako przyprawa i suplement. Zjedzenie przez dziecko 5-10 sztuk może zakończyć się zgonem (WHO 1993) fot: Harsha K R, Flickr – CC BY-SA

Wiele z tych naturalnie występujących nie jest szczegółowo kontrolowanych. Występują w bardzo różnych stężeniach, a nie są to substancje średnio mniej toksyczne niż te pochodzące z pestycydów syntetycznych. Wszystko zależy od konkretnego związku i obiektywnych kryteriów toksykologicznych. Pestycydy naturalne występują w wielu codziennych używkach takich jak kawa, herbata i papierosy.

Sama kofeina jest skutecznym pestycydem

Jak już nadmieniałem, nie stosuje się jej aktualnie w rozwiniętym rolnictwie ze względu na jej szkodliwość i brak selektywności wobec owadów. Oddziałuje na układ nerwowy zwierząt i dla człowieka, w odpowiednio niskich dawkach, ma działanie stymulujące lub rozluźniające. Nie będzie chyba zaskoczeniem, że drastycznie częstszą przyczyną powstawania nowotworów u ludzi jest spożywanie naturalnego alkoholu i palenie roślin tytoniu, niż zanieczyszczenia syntetycznymi pestycydami (Consensus Study Report: 1996).

Nowotwór częściej od używania alkoholu i tytoniu niż spożywania żywności zanieczyszczonej pestycydami

Takie problematyczne substancje występują też w zwyczajnym jedzeniu i przyprawach z roślin (warzywach, orzechach, nasionach), grzybów lub produktów zwierzęcych. Wymienić tu można np. kancerogenne aflatoksyny, neurotoksyczną solaninę, alkaloidy, glikozydy cyjanogenne. Miód nektarowy i spadziowy nie jest wyjątkiem (np. naturalnie zawiera octan benzylu). Jako ciekawostkę można wymienić trujący azjatycki miód rododendronowy, wykorzystywany gdzieniegdzie w medycynie ludowej.

W wyniku sztucznej selekcji ilość naturalnych pestycydów spada

Pocieszające jest to, że w toku ewolucji udomowionych roślin i zwierząt od czasów Neolitu, a później także w wyniku sztucznej selekcji i zabiegów biotechnologicznych zintensyfikowanych w ostatnich 60 latach, ilość szkodliwych substancji w nich zawartych średnio spadła. Dobrym przykładem mogą być tutaj ogórki, które mogą zawierać zróżnicowane stężenia trujących i gorzkich kukurbitacyn. Tysiące lat selektywnej hodowli doprowadziły do wyraźnego zmniejszenia się ich zawartości we współczesnych odmianach ogórka. Ewolucyjnym kosztem tego jest jednak niestety to, że organizmy te potrzebują obecnie więcej ludzkiej opieki, aby skutecznie bronić się przed swoimi przeciwnikami.

Kontrola żywności – czy mamy się czego bać i komu ufać?

Pestycydy stosowane przez człowieka poddane są większej kontroli, niż te wszystkie związki występujące naturalnie w organizmach w zróżnicowanych ilościach w zależności od zmienności genetycznej i warunków życia. Znane są dokładnie dawki, w jakich należy je stosować, bada się też ich działanie na organizmy żywe i środowisko jeszcze przed wprowadzeniem ich na rynek. Współcześnie bardzo dokładnymi metodami wykrywa się nawet śladowe ilości, jakimi zanieczyszczają produkty spożywcze. Ufamy, że najbardziej fachowe narodowe i międzynarodowe organizacje do tego powołane dobrze spełniają swoją rolę.

Infografika i stopnie dopuszczalnych zanieczyszczeń środkami ochrony roślin

W Unii Europejskiej przyjęte są następujące kryteria zanieczyszczeń produktów spożywczych, gdzie MRL to najwyższa dopuszczalna pozostałość w żywności. W przypadku niektórych substancji ilość ta wyrażona jest nawet w nanogramach na kilogram (jeden nanogram to miliardowa część grama: 1 g = 1 000 000 000 ng). Akceptowalna codzienna dawka ADI to taka ilość substancji, która przyjmowana wraz z żywnością przez człowieka w ciągu całego życia nie wywoła szkodliwego efektu, zaś NOAEL to maksymalny poziom, przy którym nie stwierdza się jeszcze szkodliwego działania.

Infografika ukazujące stopień zanieczyszczeń w miodzie

Do wyliczenia MRL najczęściej używany jest wysoki współczynnik bezpieczeństwa wynoszący 100, podczas gdy do obliczeń ADI wybiera się zwierzęcy układ najbardziej wrażliwy, dzięki któremu wyznacza się też parametr NOAEL. Parametry te ustalane są na podstawie wielu długoletnich badań na zwierzętach, choć bierze się też pod uwagę zarejestrowane wiarygodne przypadki ludzkich zatruć. MRL jest przy tym parametrem bardzo restrykcyjnym. Dopuszcza dużo niższą dawkę zanieczyszczeń niż ADI, także dopiero przekroczenie tego drugiego powoduje, iż dana żywność niesie ryzyko potencjalnego zagrożenia. Przekroczenie NOAEL oznacza zaś produkt ryzykowny, który powinien być wycofany ze sprzedaży (ECPA, 2014).

Zdjęcie pokazujące użycie DDT przez medyczny oddział wojskowy w Korei
Historyczne medyczne użycie DDT - Wojna w Korei 1951 - Otis Historical Archives National Museum of Health and Medicine CC BY

W ramach najnowszego, opublikowanego w 2019 roku raportu Europejskiego Urzędu ds. Bezpieczeństwa Żywności na temat bezpieczeństwa żywności pod kątem pozostałości pestycydów w żywności zebrano od 2014 do 2017 roku prawie 83 000 próbek z 28 krajów Unii Europejskiej. Stwierdzono w nim, że ryzyko dla konsumenta jest niskie - 97%  produktów spożywczych było bezpiecznych, z czego 53,6% było wolnych od jakichkolwiek obserwowalnych pozostałości, a 43,4% nie przekraczało dopuszczalnego stężenia MRL. Przy czym produkty rolnictwa „organicznego” (1,5%) przekraczały MRL rzadziej, niż produkty rolnictwa konwencjonalnego (4,3%).  Jeżeli chodzi o miód, zebrano 659 próbek i przeanalizowano je pod kątem pozostałości 589 pestycydów. W 70,4% przypadków nie znaleziono żadnych zanieczyszczeń, w 27,8% wykryto dopuszczalne pozostałości poniżej MRL, a jedynie 1,8% próbek miodu przekroczyło dopuszczalne maksimum (EFSA, 2019).

Ewolucyjne korzyści i straty

Może się jednak pojawić jeszcze inny kontrargument, który sam kiedyś uznawałem za znaczący. Jeżeli człowiek spożywa o wiele więcej naturalnie występujących pestycydów, to być może mimo wszystko można je uznać z założenia za mniej szkodliwe – nawet jeżeli wiele z nich mogłoby być potencjalnie bardziej ryzykownych, niż te wyprodukowane syntetycznie? Zakładamy tu, że poprzez miliony lat ewolucji człowiekowatych Homo sapiens wykształcił mechanizmy uodparniające na działanie tych trucizn np. odpowiednie szlaki metaboliczne, czy mechanizmy transportu komórkowego. Niestety nie jest to argument prawdziwy. Wystarczą szybkie studia nad groźnymi i powszechnymi substancjami w żywności, aby przekonać się, że człowiek nie jest odporny na szkodliwe dawki wielu naturalnych substancji w jedzeniu jak np. botulina, aflatoksyny, solanina, glikozydy cyjanogenne.

Człowiek nie jest odporny na mnóstwo naturalnych pestycydów

Organizmy tolerują dawki pewnych substancji dzięki mechanizmowi, który umożliwia detoksyfikację całej grupy chemicznie podobnych do siebie substancji trujących, a związki syntetyczne są substancjami chemicznie identycznymi z ich naturalnymi odpowiednikami lub są pochodnymi tych naturalnych. Ewolucyjnie byłoby to nieefektywne, gdyby np. roślinożerca był oddzielnie odporny na każdy z bardzo wielu naturalnych roślinnych pestycydów (Ames, Profest i Gold, 1990). Poza tym nie należy zapominać, że selekcja naturalna nie jest wszechmocna. Ma swoje ograniczenia, a każda korzyść, którą jest jakaś dodatkowa umiejętność biochemiczna, ma swoje koszty. Wynikiem tego organizmami dopasowanymi do środowiska nie są te, które nie mają żadnych wad. 

Życie generalnie jest zazwyczaj balansowaniem pomiędzy zyskami a stratami.

Wiele z naturalnie występujących szkodliwych substancji w odpowiednio małych dawkach może być ogólnie korzystna. Nie inaczej jest z substancjami syntetycznymi. W końcu, jak doskonale wiadomo, leki przywracające zdrowie i ratujące życie mają również swoje skutki uboczne, a od pewnej dawki są zazwyczaj truciznami. Dokładnie ta sama właściwość dotyczy leków pochodzenia naturalnego i generalnie żywności, czy nawet wody.

Kontrowersyjny DDT

Zdjęcia pokazujące współcześnie rozpylanie DDT w Afryce
Kenia - współczesne medyczne użycie DDT 2013 - Global Environment Facility CC BY-NC-SA

Uznawany za jeden z najbardziej problematycznych syntetycznych pestycydów to słynny związek o akronimie DDT. Został on wyeliminowany z krajów rozwiniętych z użycia w rolnictwie, a zastąpiony przez środki bardziej bezpieczne dla ludzi i środowiska naturalnego. Po kilkudziesięciu latach niestosowania (w Polsce od 1976 roku) jest wciąż znajdowany w glebie i produktach spożywczych na terenie Unii Europejskiej (EFSA, 2019). Jednak nawet taka substancja jak DDT ma też swoje dobre strony. Owszem, jego produkty rozpadu kumulują się w środowisku, a przez to posiadają groźne efekty uboczne dla człowieka (wiele publikacji wskazuje, że mogą przyczyniać się do zwiększenia ryzyka wystąpienia groźnych chorób np. o podłożu hormonalnym, nowotworowym czy neurologicznym). Skumulowane zanieczyszczenia zaszkodziły różnym innym organizmom, od których prawdopodobnie zależymy jako populacja lub takim, dzięki którym wpadamy w zachwyt nad zjawiskami w przyrodzie. Warto jednak przypomnieć, że pestycyd ten ocalił wiele milionów ludzi przed śmiercią z powodu m.in. malarii, dengi, tyfusu. Nadal zresztą z tego powodu ratuje życie w krajach trzeciego świata, kiedy nie ma innych lepszych alternatyw, a jego derywat (pochodna) pod nazwą Mitotan, wciąż jest używany w postaci leku ludzkiego i weterynaryjnego np. na pewne rzadkie przypadki nowotworów i Zespół Cushinga (ATSDR, 2019).

Głos rozsądku

Z wyżej wymienionych powodów, kiedy oceniamy różne pestycydy, lepiej powoływać się na racjonalne argumenty takie jak: powody użycia, dostępność, toksyczność, selektywność, synergię z innymi substancjami i chorobami oraz czas degradacji i stopień kumulacji w środowisku. W tym ostatnim aspekcie rzeczywiście pestycydy tzw. „organiczne” lub „naturalne” mogą mieć przewagę. I w tym znaczeniu można by nazwać je lżejszą chemią, ale tylko pod warunkiem uśrednienia. 

Pestycydy naturalne mogą być lepsze

Jednak istotnym jest, by nie wrzucać odmiennych substancji do takich zbiorów, w których traktowane są podobnie. Korzystniej przeanalizować każdy preparat indywidualnie oraz być otwartym na zmianę poglądu pod wpływem nowych rzetelnych informacji. Analizy naukowe wskazują zresztą, że w przypadku np. pszczół (mam na myśli wszystkie gatunki Apiformes) nie wystarczy tylko analizować oddziaływania substancji pojedynczo, ale biorąc pod uwagę efekt synergistyczny trzeba analizować wpływ tych substancji także jedna na drugą. Jeden pestycyd może bowiem wzmacniać efekt drugiego a przez to powodować, że mało groźny związek staje się niebezpieczny (Sanchez-Bayo, Goka, 2016).

Synergiczne działanie komplikuje sprawę

Z tego powodu takie nierzetelne podziały pestycydów, odwołujące się do naturalności, np. na „miękkie” i „twarde”, stają się jeszcze bardziej niejednoznaczne. Nie wiara w „chemiczne siły natury”, a obiektywne kryteria biochemiczne, toksykologiczne, czy fachowe wyważenie korzyści i strat, powinny stanowić o wyborze tej czy innej substancji pod kątem jej mocniejszego czy słabszego oddziaływania lub trwalszego czy krótszego pozostawania w środowisku.

Rolnictwo ekstensywne i intensywne nastawione na minimalizację użycia bardziej szkodliwych pestycydów jest zjawiskiem pożytecznym. Wydaje się jednak, że sensownym jest, gdy jego reguły opierają się na bardziej racjonalnym namyśle, który waży zyski i straty bez ideologicznej żarliwości, czy dogmatycznego podziału opartego o nierzetelne stosowanie tylko pozornie fachowych pojęć, co może prowadzić do dezinformacji. Motywacja emocjonalna jest często nacechowana radykalizmem w postrzeganiu świata, a rzeczywistość jak widać potrafi być bardziej zniuansowana niż czarno-białe spojrzenie na dane zagadnienie.

Jakub Jaroński 2020

Konsultacja: dr Monika Mętrak – biogeochemik i toksykolog w Zakładzie Ekologii Roślin i Ochrony Środowiska na Wydział Biologii Uniwersytetu Warszawskiego

Ps: Prezentowane w tym artykule informacje mają jedynie charakter informacyjny i edukacyjny. Nie zastępują porady weterynaryjnej.

Literatura:

  1. Witold Danikiewicz: „Chemia organiczna”, Warszawa 1995
  2. PubChem, baza danych związków chemicznych zarządzana przez National Center for Biotechnology Information (NCBI), który jest częścią National Library of Medicine, który z kolei jest instytucją podległą United States National Institutes of Health (NIH)
  3. Zasoby strony internetowej: The North Carolina Department of Agriculture and Consumer Services
  4. Hanan A. Gashout, Paul H. Goodwin, Ernesto Guzman-Novoa: „Lethality of synthetic and natural acaricides to worker honey bees (Apis mellifera) and their impact on the expression of health and detoxification-related genes”, Environmental Science and Pollution Research / Springer Nature 2018
  5. Francisco Sanchez-Bayo, Koichi Goka, Beekeeping and Bee Conservation - Advances in Research, Chapter: 4: „Impacts of Pesticides on Honey Bees”, 2016
  6. Christian C. Abnet: „Carcinogenic Food Contaminants”, Cancer Investigation 2007
  7. Consensus Study Report: „Carcinogens and Anticarcinogens in the Human Diet, A Comparison of Naturally Occurring and Synthetic Substances”, National Academies Press (USA) 1996
  8. Bruce N. Ames, Margie Profest, Lois Swirsky Gold: „Dietary pesticides”, Medical Sciences 1990
  9. Toxicological evaluation of certain food additives and naturally occurring toxicants, Food Additives Series, No 30, WHO, Genewa 1993
  10. Europejski Urząd ds. Bezpieczeństwa Żywności (EFSA): „The 2017 European Union report on pesticide residues in food”, EFSA Journal 2019
  11. Europejskie Stowarzyszenie Ochrony Roślin (ECPA): „Pesticide use and food safety”, 2014
  12. Agency for Toxic Substances and Disease Registry: „Toxicological Profile for DDT, DDE, and DDD”, U.S. Department od Health and Human Services, 2019
  13. Jolanta Kumirska Marek Gołębiowski Monika Paszkiewicz Anna Bychowska: „Analiza żywności - Skrypt dla studentów Ochrony Środowiska”, Gdańsk 2010 
  14. Irena SiegIeń, „Cyjanogeneza u roślin i jej efektywność w ochronie roślin przed atakiem roślinożerców i patogenów”, Kosmos 2007 
  15. Hans Rosling: "Factfulness - „Dlaczego świat jest lepszy, niż myślimy, czyli jak stereotypy zastąpić realną wiedzą", 2018
  16. January Weiner: „Życie i ewolucja biosfery”, Warszawa 2006 
  17. Wojciech Zalewski: „GMO obiektywnie”, blog internetowy: 2020 
  18. Strona internetowa: Rationalwiki. Hasło: „Appeal to nature"

Poranek na żywo w radio

Warroza była zaproszona do poranka w Radio Wnet. Tym razem to ona udzielała wywiadu na żywo: https://wnet.fm/2021/03/18/janusz-jaroszewski-rowniez-owady-maja-zachowania-kulturowe-mrowki-i-termity-stosuja-kwarantanne/

Mówiła o tzw. wymieraniu pszczół, wyścigu ewolucyjnym pomiędzy pszczołami, różnorodności ich gatunków oraz o zachowaniach kulturowych trzmieli i kwarantannie u mrówek. Wskazywała, że akurat ten gatunek pszczoły jako populacja w Polsce jest coraz liczniejszy i trudno się zgodzić wobec faktów, że wymiera lub jest poważnie zagrożony. Tak mówią twarde dane statyczne. Tutaj też o tym ile na świecie może być pszczół miodnych: https://www.warroza.pl/2020/07/ile-jest-pszczol-miodnych.html

W Polsce notuje się systematyczny wzrost rodzin pszczelich

Inaczej jest jednak w przypadku części pszczół niemiodnych. Powodem tego jest walka ewolucyjna 450 różnych gatunków pszczół. Wyjadają sobie one nawzajem pożywienie. Również w obrębie jednego gatunku pszczoły rywalizują się sobą, niejednokrotnie w sposób drastyczny lub wojenny. Silna rodzina pszczół potrafi zabić słabą bez litości.

Również w obrębie jednego gatunku pszczoły toczą między sobą wojnę

Owady mają również zachowania kulturowe. Warroza wyjaśniła, że trzmiele należą do rodziny pszczołowatych. Jednak szerszenie, choć też należą do rzędu błonkoskrzydłych, to należą do rodziny osowatych.

Owady mają zachowania kulturowe

Było też o tym, że osobniki owadów społecznych potrafią się uczyć. Udowodniono to na badaniach eksperymentalnych na trzmielach. Trzmiele potrafią przejść przez prosty labirynt i przekazać tę wiedzę innym członkom swego gniazda. Mrówki potrafią stosować kwarantannę. Wywiad zakończył się refleksją, że być może za 500 lat technologia pozwoli na skomunikowanie się człowieka z owadami. Warroza żałuje, że nie będzie wtedy żyła, aby móc się tego dowiedzieć, gdyż główną motywacją do zainteresowania Warrozy owadami jest po prostu ciekawość jak działa i jak zbudowany jest wszechświat, w tym jego biologiczna część.

Wirus - życie czy nie?

Celem poniższej pracy jest próba pochylenia się nad problemem, jakim jest uznanie przynależności wirusów do świata ożywionego. Temat ten wciąż jest przedmiotem wielu naukowych sporów, ponieważ dotyczy dwóch niezwykle ważnych dla współczesnej nauki kwestii, które wciąż nie doczekały się rozwiązania: gdzie leży granica między systemem biologicznym i abiologicznym oraz w jaki sposób należy zakwalifikować biologiczne układy bezkomórkowe (wirusy, wirioidy i priony) aby przedstawić ich powiązanie z ewolucją życia na Ziemi?

Widoczne wiriony wirusa przez mikroskop
Wiriony pod mikroskopem elektronowym szczepu B HBV wirusowego zapalenia wątroby, fot: Microbe World

W zależności od przedstawionych wyjaśnień wirusy można postrzegać jako wyspecjalizowane, zredukowane do minimum pasożyty wewnątrzkomórkowe lub jako niezwykle złożone efekty uboczne zjawiska horyzontalnego transferu genów. Jednak, aby móc zastanowić się nad tym, czy uznanie istnienia ,,czwartej domeny” ma sens (obok eukariontów, prokariontów i archeonów) należy najpierw przyjrzeć się współczesnym sposobom definiowania podstawowego przedmiotu badań nauk biologicznych.

W przeciwieństwie do przednaukowych założeń o nadnaturalnych przyczynach istnienia życia oraz koncepcji witalizmu - zakładającej, że różnica między materią ożywioną, a nieożywioną ma charakter jakościowy zaś fizykochemiczny opis jest niewyczerpujący - obecnie żaden przedstawiciel nauk ścisłych nie ma wątpliwości, że życie, choć jest systemem emergentnym, podlega takim samym prawom fizyki i chemii jak materia nieożywiona. Z tego powodu można badać je tak samo jak środowisko abiotyczne. Dzięki wyłączeniu czynnika transcendentalnego biologia mogła stać się nauką w pełni empiryczną i eksperymentalną, bez czego nie byłby możliwy rozwój takich nauk jak biotechnologia, biologia molekularna lub biomedycyna. Mimo niezaprzeczalnych osiągnięć, wciąż podanie spójnej i uniwersalnej definicji życia wydaje się, zdaniem niektórych badaczy niezwykle trudnym zadaniem, ponieważ niemal zawsze w biologii można natknąć się na wyjątek od reguły.

Życie podlega takim samym prawom fizyki i chemii jak materia nieożywiona

Za najprostszą definicję życia można uznać zdanie Tibora Gánti, węgierskiego biologa i biochemika, a zarazem twórcy teorii chemotonu „system wykazujący permanentną wymianą materii i energii między żywym organizmem a jego otoczeniem, zdolny do utrzymywania homeostazy, rozmnażania się i dziedziczenia cech osobnika rodzicielskiego przez osobniki potomne”. Tibor Gánti przedstawił osiem podstawowych warunków jakie powinien wykazywać system złożony, aby mógł zostać zakwalifikowany jako organizm: musi być odgraniczony od środowiska, posiadać przemianę materii, utrzymywać homeostazę, posiadać system zapisu i odczytu danych, być wyposażony z system samoregulacji, być zdolny do wzrostu, wykazywać śmiertelność oraz ulegać podziałowi w momencie którego zachodzą procesy których skutkiem jest zmienność. Z kolei inny wybitny umysł XX wieku Erwin Schrödinger w swoim krótkim eseju zatytułowanym: ,,Czym jest życie? Fizyczne aspekty żywej komórki” przedstawił życie jako ciekłokrystaliczny materiał o właściwościach analogicznych do ferromagnetyka lub nadprzewodnika, który utrzymuje niewiarygodnie niski poziom entropii1 wewnętrznej poprzez jej zwiększanie w swoim otoczeniu. Należy pamiętać, że były to czasy zanim prawa genetyki oraz rola DNA w procesie dziedziczenia zostały opisane.

Fizyk teoretyczny Freeman Dyson, Amerykanin brytyjskiego pochodzenia, przedstawił swoje własne wyjaśnienie zjawiska biogenezy, jako nałożenia się na siebie dwóch pierwotnie niezależnych procesów chemicznych: replikacji i metabolizmu. Zgodnie z tym modelem aparat metaboliczny stał się źródłem zasilania i substratów dla replikatora, zaś cząsteczka dzieląca się na skutek integracji utrwaliła w swojej strukturze informację o właściwościach i składzie chemicznym molekularnego „akumulatora”, dzięki czemu mógł być odbudowywany przy każdym następnym podziale. Według definicji Dysona metabolizm i replikacja są jakby dwiema stronami tego samego medalu i tylko jako jedność mogą stanowić system żywy. Z kolei dla geochemika z należącego do NASA Jet Propulsion Laboratory Michaela Russella, najistotniejszą właściwością żywego organizmu jest wykorzystywanie pobranej z otoczenia energii do polimeryzacji związków organicznych. Zapytany, co w jego opinii jest istotą życia odpowiedział: ,,To proste. Celem życia jest uwodornianie dwutlenku węgla”. Nick Lane, inny uczony, biochemik pracujący na wydziale Genetyki, Ewolucji i Środowiska na University College London za początek życia uznaje pojawienie się w zupie pierwotnej pęcherzyka fosfolipidowego obdarzonego polaryzacją. Wraz z gradientem elektrochemicznym i różnicą w warunkach elektrochemicznych między środowiskiem we wnętrzu i na zewnątrz błony doszło do powstania procesów permanentnie odtwarzających różnice potencjałów. Według tej definicji proces replikacji jest skutkiem aktywności elektrochemicznej, gdyż zbyt duże napięcie w poprzek błony komórkowej, powodowało rozszerzanie się protokomórki, a w efekcie jej podział na dwa pomniejsze pęcherzyki błonowe. Przetrwały tylko te, które ,,nauczyły się” kodować na zgromadzonych w swoim wnętrzu cząsteczkach instrukcje pozwalającą utrzymywać gradient elektrochemiczny i przywracać go, jeżeli na skutek zmian w środowisku został utracony.

Otwarte ramki odczytu wirusa
Geny wirusa DWV (pszczeli wirus zdeformowanych skrzydeł) typu A oraz jego wiriony w mikroskopie elektronowym

Wyjątkowo niekonwencjonalną, uznaną przez większość naukowców zajmujących się biogenezą za kontrowersyjną, definicję życia przedstawił Jim Al.-Khalili, szef katedry fizyki teoretycznej na Uniwersytecie w Surrey. Jim Al.-Khalili prowadził badania z zakresu mechaniki kwantowej, na których podstawie doszedł on do wniosku, że pierwszy organizm oznaczony skrótem B.U.L (Basic Unit of Life) jest efektem podtrzymywania splątanego stanu kwantowego w cytoplazmie odseparowanej od szumu otoczenia za pośrednictwem struktur takich jak błona biologiczna, otoczka śluzowa, lub ściana komórkowa. Za jeden z dowodów przemawiających za tą hipotezą uznaje on nietypową budowMicrobe Worldę błon komórkowych występujących u archeonów. W przeciwieństwie do dwóch pozostałych domen świata ożywionego błona komórkowa archeonów nie jest dwuwarstwą lecz monowarstwą, która opiera się na wiązaniach eterowych w kwasach tłuszczowych zamiast na estrowych, jak u innych form życia. Istnienie eterowej monowarstwy ma wynikać z potrzeby zabezpieczenia kwantowej synchronizacji, której efektem są wszystkie zjawiska biologiczne. Większość środowiska naukowego jest jednak zdania, że brak obecnie wystarczających dowodów, aby za istotę aktywności biologicznej uznać utrwalanie sieci kwantowych splątań.

Stuart Kauffman, emerytowany profesor biochemii na Uniwersytecie w Pensylwanii, współtwórca biologii systemów, upatruje przyczyn istnienia życia nie w sprzężeniu stanów kwantowych, lecz w utrzymywaniu w pojedynczej komórce obwodu złożonego z wiązań wodorowych, w obrębie których zachodzi ciągła wymiana kationów wodorowych. Tym samym bezpośrednią przyczyną biogenezy byłyby spontanicznie powstające układy supramolekularne, których samoorganizacja wynikałaby z właściwości wiązań2 wodorowych ulegających w sposób ciągły zerwaniu jak i odbudowie w najkorzystniejszy z punktu widzenia energetycznego kształt cząsteczki.

Niezwykle prostą, a równocześnie uniwersalną definicję, nazwaną cybernetyczną przedstawił polski profesor biotechnologii z Uniwersytetu Jagiellońskiego, Bernard Korzeniewski. Brzmi ona: ,,Życie to system sprzężeń zwrotnych ujemnych podporządkowanych nadrzędnemu sprzężeniu zwrotnemu dodatniemu”. Zakłada on, że najprostszym modelem życia jest samoregulujący się termostat zdolny do samodzielnego pobierania energii i części zamiennych ze swojego otoczenia.

Wszystkie powyższe próby opisania życia kładą nacisk na występowanie stanu dynamicznej równowagi podtrzymywanej przez ten system. Różnice między nimi wynikają z odmiennych poglądów na temat przyczyn i mechanizmu tego procesu. W opozycji do nich można zaprezentować wyjaśnienia redukcjonistyczne, uznające za kluczowy proces replikacji, zaś metabolizm spychające do roli źródła zasilania dla replikatora. Najbardziej znanym przedstawicielem tego nurtu jest popularyzator nauki, przedstawiciel neoateizmu i krytyk szeroko rozumianego religijnego myślenia Richard Dawkins. W swojej słynnej popularnonaukowej książce ,,Samolubny Gen” przedstawił koncepcję, według której organizmy są tylko inkubatorami, dla kodujących informację o ich budowie genach. Chcąc zawęzić poglądy przedstawione w tej publikacji do pojedynczego zdania można sformułować je tak: ,,Życie to zbiór autonomicznych replikatorów zdolnych do ewolucji.” Zgodnie z tą definicją formami życia są również systemy i zjawiska nieuznawane za część świata ożywionego. Sam Richard Dawkins jest autorem hipotezy istnienia memu. Mem jest to skrót od wyrażenia: memory’s gen, czyli gen pamięci. Według niej przekaz kulturowy wykazuje wiele cech wspólnych z przepływem genów, a umysł i behawior jest jakby tym dla owych replikatorów, czym komórki dla genów. Sam Richard Dawkins oficjalnie manifestując swoją wrogość wobec religii często porównuje je do wirusów, a uznawanie jego zdaniem niedorzecznych dogmatów sprzecznych z wiedzą naukową za efekt działania ,,wirusa wiary”. Paradoksalnie zgodnie z modelem memetyki ideologie są w kulturze tym, czym wirusy w środowisku naturalnym. Oznacza to, że zdaniem zwolenników tej hipotezy myśli i rytuały też w pewnym sensie są ,,organizmami”.

Zapoznając się z różnymi sposobami wyjaśnienia czym jest to niezwykłe zjawisko, którego jesteśmy nieodłączną częścią, możemy powrócić to tematu przewodniego, czyli próby zaklasyfikowania wirusów jako form życia, lub tylko produktu jego aktywności. Zanim przejdziemy do argumentacji na rzecz obydwu opinii, warto przedstawić obecne poglądy na temat filogenetyki wirusów, ponieważ jest ona ściśle związana z tym, czy istotniejszy jest metabolizm, czy też replikacja. Zdaniem jednej z nich wirusy pochodzą od organizmów pasożytniczych, które na drodze doboru naturalnego uległy daleko idącej redukcji, pozbywając się organelli, cytoplazmy oraz własnego metabolizmu kodując w swoim materiale genetycznym mechanizmy pozwalające przejmować metabolizm żywiciela. Uwalniany do otoczenia kapsyd według tej hipotezy jest zredukowanym przetrwalnikiem uaktywniającym się w cytoplazmie. Wirus więc wraca do życia tylko kiedy wchodzi w interakcję z transkrypcyjną i translacyjną molekularną maszynerią gospodarza. 

Wirusy posiadające cechy zbliżające je do komórek

Wirusolodzy postrzegający wiriony, czyli pojedyncze cząsteczki wirusa jako wyspecjalizowane endospory w dużej mierze bazują na odkryciu tzw.: mimiwirusów, zwanych też super wirusami. Owe nietypowe organiczne struktury odkryto w roku 1992 w przemysłowej wieży chłodniczej w Bradford. Początkowo ze względu na swoje rozmiary, złożoność genomu oraz posiadanie wielowarstwowej błony komórkowej zostały uznane za bakterie3 pasożytujące na amebach. Dopiero kolejne badania wskazujące na brak rybosomów, jak i znajdywanie kolejnych ,,bakteriomorfów” choćby na lodowych pustyniach Antarktydy, pozwoliły udowodnić, że są to niezwykle złożone wirusy posiadające cechy zbliżające je do komórek, jednak tylko pod względem strukturalnym, a nie funkcjonalnym. Należy jednak zwrócić uwagę na fakt, że znacznie popularniejsza jest hipoteza zgodnie z którą początków istnienia wirusów należy dopatrywać się w horyzontalnym przekazie genów za pośrednictwem plazmidów. Plazmidy są to niewielkie, koliste cząsteczki DNA umożliwiające organizmom prokariotycznym oraz archeonom (rzadziej eukariontom) proces transformacji, czyli nabywania nowych genetycznych cech bez potrzeby koniugacji. Dzięki temu organizm może zyskać biokatalizatory, które np.: pozwalają bakterii na zyskanie oporności na konkretny szczep antybiotyków. Wystarczy jednak, że pewna część plazmidów jest niefunkcjonalna, ponieważ po wniknięciu do cytoplazmy zaburza metabolizm i indukuje produkcję tylko własnych kopii, nie przynosząc korzyści biorcy. Ponieważ komórki biorców starały się zwalczać zakłócające ich pracę plazmidy dokonywały ich selekcji naturalnej, na skutek której w obiegu pozostały tylko niefunkcjonalne plazmidy, zdolne do przetrwania w niekorzystnym środowisku zewnętrznym, jak również uniknięcia wykrycia i dezaktywacji przez wyspecjalizowane systemy wewnątrzkomórkowe. Można więc stwierdzić, że powstanie wirusów to konsekwencja wyodrębnienia się procesu transdukcji z procesu transformacji. Oba procesy znalazły szerokie zastosowanie w biotechnologii do otrzymywania organizmów transgenicznych. W przypadku transformacji wektorem przenoszącym informację genetyczną jest plazmid, zaś w procesie transdukcji rolę plazmidu pełni wirion. Ostatnio coraz popularniejszą metodą edycji genów, która może w przyszłości posłużyć do wykonywania terapii genowych jest technika CRISPR. Polega ona na wykorzystaniu mechanizmu wykrywania i wycinania wirusów o nazwie Cas9, pozwalający komórkom na uniknięcie roli żywiciela.

Grafika struktury białka
Jedno z białek kodowanych przez gen wirusa DWV

Zwolennicy pierwszej hipotezy są zdania, że wirusy należy zaklasyfikować jako przedstawicieli tzw.: życia bezkomórkowego. Natomiast pozostali naukowcy przekonują, że wirusy są zbyt prostymi jednostkami aby móc uznać je za pełnoprawne organizmy. Ponieważ znacznie więcej argumentów przemawia za zanegowaniem przynależności wirusów do świata ożywionego, należy zacząć od przedstawienia argumentów falsyfikujących najpowszechniejszy pogląd na ten problem. Jakie więc właściwości posiadają wirusy, które pozwoliłyby za utworzenie z nich czwartej domeny życia na Ziemi? Oczywiście za podstawową cechę uważa się zdolność do powielania się z drobnymi błędami pozwalającymi im nabywać nowe właściwości zwiększające adaptację do pasożytnictwa wewnątrzkomórkowego. Ponadto wirusy oparte są na tym samym kodzie genetycznym co wszystkie formy życia. Są zdolne do transkrypcji, translacji a ostatecznie uwolnienia się komórki gospodarza. Potrafią zakłócać wewnątrz cytoplazmatyczne mechanizmy w taki sposób, aby umożliwić proces składania własnych otoczek białkowych. Wirusy podlegają prawom klasyfikacji taksonomicznej zgodnej z zasadami przyjętymi przez Karola Linneusza. Można układać na podstawie ich materiału genetycznego drzewa filogenetyczne na bazie których można określać ich wzajemne pokrewieństwo.

Najistotniejszą właściwością wirusów sugerującą, że są niezwykle prostą, ale mimo wszystko formą życia, jest ich zdolność do wykrywania potencjalnych zagrożeń, jakie mogą doprowadzić do obumarcia ich żywiciela. Poprzez nie do końca jeszcze poznane mechanizmy wirus przechodzi z formy utajonej na aktywną, jeżeli wykryje, że gospodarz ma niewystarczającą ilość pożywienia lub, że jest otoczony innymi organizmami, które mogłyby zostać potencjalnymi nosicielami. Potwierdza to niedawno4 dokonane odkrycie sugerujące, że wirusy wykrywają zagęszczenie innych organizmów w pobliżu zainfekowanej komórki. Dzięki temu z punktu widzenia ewolucji mają możliwość wydostania się gdy w okolicy są inni potencjalni żywiciele. Jednak na tym kończą się argumenty na podstawie których można wyciągnąć wniosek o wykazywaniu przez systemy wirusowe właściwości układów żywych. Argumentację na rzecz przeciwnej tezy należy zacząć od podstawowego faktu, że w przeciwieństwie do trzech domen życia wirusy ulegają procesowi namnażania, a nie rozmnażania. To bardzo istotna różnica. Nie mamy tu bowiem podziału komórkowego prowadzącego do powstania dwóch komórek potomnych z pojedynczej rodzicielskiej lecz produkcję milionów kopii na podstawie wirionu modelowego na molekularnej taśmie produkcyjnej. Poza granicami komórki żywiciela wirusy nie wykazują jakichkolwiek cech właściwych organizmom. Poza konstrukcją białkowego kapsydu nie posiadają wydzielonej ze środowiska przestrzeni wewnętrznej. Nie są zdolne do wzrostu, ani nie zmieniają się pod wpływem otoczenia

Retro: DWV, HIV i SARS-Cov2

Każdy nowo utworzony wirion jest już w pełni ,,dojrzały” do znalezienia sobie gospodarza. Obecne badania sugerują, niezdolność wirusów do jakiegokolwiek ruchu aktywnego. Oznacza to, że nie mogą czynnie poszukiwać komórek, aby do nich wniknąć w sposób analogiczny jak gamety męskie lub endobakterie. Istotną kwestią jest fakt, że do czynnej infekcji (po adsorpcji do komórki) zdolne są tylko bakteriofagi i wirusy komórek zwierzęcych. Wirusy roślinne (np. wirus mozaiki tytoniowej) jak i wirusy grzybów, nie są zdolne dostać się do cytoplazmy bez obecności mechanicznych uszkodzeń ściany komórkowej. Wirus nie wymienia energii ani materii ze swoim otoczeniem oraz oczywiście jest niezdolny do reakcji na bodźce. Niektóre wirusy zwierzęce posiadają otoczkę fosfolipidową zawierającą receptory ułatwiające wniknięcie do komórki lecz nie jest ona ich wytworem, a jedynie formą płaszcza ochronnego, który otacza je na skutek procesu egzocytozy. Pojedynczy wirion nie posiada też wieku biologicznego, przez co nie wykazuje oznak starzenia się, a proces unieszkodliwienia go przebiega w identyczny sposób jak denaturacja białek i polega na odkształceniu jego wyższych struktur. Niektóre wirusy są w gruncie rzeczy pojedynczymi cząsteczkami ulegającymi procesowi krystalizacji, który w żaden sposób nie wpływa na ich wirulentność, czyli potencjał infekcyjny. Nie wszystkie wirusy mają nawet materiał genetyczny w postaci DNA lecz często jest nim RNA. Noszą wtedy nazwę retrowirusów. Do tej grupy należy wirus DWV, HIV i SARS-Cov2. Ze względu na to, że RNA jest bardziej niestabilny od DNA, a przepisująca informację z RNA na DNA odwrotna transkryptaza popełnia wiele błędów retrowirusy są bardzo zmienne i niezwykle trudne jest wytworzenie inaktywujących je przeciwciał. Nie można zapominać o fakcie, że technicznie rzecz biorąc nie są wcale autonomicznymi replikatorami, ponieważ potrzebują niezwykle skomplikowanego aparatu enzymatycznego służącego replikacji materiału genetycznego infekowanych przez nie organizmów. Oznacza to, że przy braku w ich otoczeniu żywych komórek wirus zachowuje właściwości złożonych polimerów i nic nie wskazuje na jego żywą naturę. Ostatni argument warty przytoczenia świadczący za tym, że uznanie wirusów za czwartą domenę życia nie znajduje uzasadnienia jest możliwość abiotycznej syntezy całych wirionów na identycznych zasadach jak genoforów bakteryjnych i plazmidów. Wyprodukowane na drodze chemicznej biopolimery nie różnią się jakościowo od tych syntetyzowanych w komórkach. Fakt sprawia, że bliżej im do molekularnych automatów, niż najprostszych aktywnych biochemicznie systemów komórkowych, które wciąż pozostają poza zasięgiem chemicznej syntezy.5

Wirusy nie powinny zostać uznane za autonomiczne formy życia

Reasumując, wirusy nie powinny zostać uznane za autonomiczne formy życia. Nie tylko dla tego, że nie mają struktury komórkowej, ani aparatu metabolicznego lecz ze względu na konsekwencje jakie niosłoby ich włączenie do filogenetycznego drzewa życia. Obecne definicje życia są stosunkowo niejednoznaczne. Mimo wszystko jesteśmy w stanie postawić w miarę określoną granicę miedzy tym co żywe, a tym co nieożywione. Uznanie za żywe, tak prostych układów jak wirusy, oznaczałoby zburzenie tej granicy, w pewnym sensie powrót do myśli o samorództwie. Zgodnie z zasadą brzytwy Ockhama w nauce należy zawsze wybierać najmniej skomplikowane wyjaśnienie. Natomiast nadanie wirusom miana form życia skomplikowałby tylko i tak niepełne definicje życia. Powodem tego jest fakt występowania wielu systemów, które pod względem działania zachowują się jak wirusy. Aby zachować konsekwencję należałoby je również określić mianem organizmów. Przede wszystkim pojedyncze geny, plazmidy, a także pojedyncze sekwencje syntetyzowane metodą PCR, musiałyby zostać rozpatrzone jako niezależne formy życia. Również ludzkie idee, czy przekazywane w społeczeństwie wartości, a nawet wiedza o projektowaniu konkretnych narzędzi i urządzeń zostałyby potencjalnie zakwalifikowane jak organizmy o bliżej nieokreślonej naturze. Przede wszystkim jednak pod znakiem zapytania stanęłyby wytwory technologii i elektroniki, zaczynając od wirusów komputerowych, a kończąc na zdalnie sterowanych taśmach produkcyjnych, zdolnych na podstawie dostarczonego im układu scalonego produkować niezliczoną ilość jego kopii. Tym samym uznanie wirusów za organizmy wiązałoby się z utworzeniem jeszcze piątego królestwa: urządzeń elektronicznych zdolnych do taśmowej produkcji własnych części i kopii na podstawie odczytu danych zapisanych we własnej strukturze.

Kacper Jerzy Piwowarek (Wydział Antropozoologii Kolegium Artes Liberales) 

Bibliografia:

  1. Al-Khalili J. Życie Na Krawędzi Era Kwantowej Biologii wyd. Prószyński i S-Ka Warszawa 2016
  2. Brooks M. 13 Rzeczy które nie mają Sensu wyd. Literackie Warszawa 2011
  3. Carroll S. Nowa Perspektywa; Pochodzenie Życia, Świadomości i Wszechświata wyd. Prószyński i S-Ka Warszawa 2017
  4. Clancy P. W Poszukiwaniu Życia Badania Układu Słonecznego wyd. Prószyński i S-Ka Warszawa 2008
  5. Dawkins R. Samolubny Gen wyd. Prószyński i S-Ka Warszawa 2012
  6. Doudna J.A. Edycja Genów Władza Nad Ewolucją wyd. Prószyński i S-Ka Warszawa 2018
  7. Dyson G. Darwin wśród maszyn: rzecz o ewolucji inteligencji wyd. Prószyński i S-Ka Warszawa 2005
  8. Gánti T. Podstawy Życia wyd. Wiedza Powszechna Warszawa 1986
  9. Kofta W. Postawy Inżynierii Genetycznej wyd. Prószyński i S-Ka Warszawa 1999
  10. Konieczny L. Biologia systemów: Strategia działania organizmu żywego wyd. PWN Warszawa 2010
  11. Korzeniewski B. Trzy Ewolucje Ewolucja świata, życia i świadomości wyd. KORONA Kraków 1998
  12. Lane N. Pytanie o Życie; Energia, Ewolucja i Pochodzenie Życia wyd. Prószyński i S-Ka Warszawa 2016

Wykorzystane strony internetowe:

  1. https://kopalniawiedzy.pl/wirus-systematyka-Klosneuwirus,26254
  2. https://kopalniawiedzy.pl/VP882-wirus-bakteria-bakteriofag-quorum-sensing,29279
  3. https://www.focus.pl/artykul/megazagadki-mikroswiata-wirusy-ciagle-zaskakuja-badaczy
  4. http://przystaneknauka.us.edu.pl/artykul/zywe-czy-niezywe-czyli-problem-z-wirusam

 

Cały genom wirusa DWV (pszczeli wirus zdeformowanych skrzydeł) typu A:

auuuuauuuuaaugcugucuuuauugcugauuuauuuugcuguuuuuauuuguuauuuuauauuugcuaauuuucauuauugcgaaauauauugcauugcuauuuuuauuauauacgcuagauucaauuuuauuuuucuuauauuuucaauuuaauuuugauuuugaagguaaauauauauaauuaauuauuaaaaauggccuuuagcugcggaacccuuucuuacucugccgucgcccaagcuccgucuguugcccaugcaccucguacaugggaaguugaugaagcuaggcggcgccgaguuauuaaacguuuggcgcuggagcaagaacguaugcguaacguucuugaugcuagcgucuaugaccaggcaacaugggaacaggaggaugcgcgcgauaaugaguuccuaauggaacaacuaaauaauuuauauacuauuuauucgaucgcugaacgcuguacgcgucggccuaucaaagagcauucuccuauaucaguuucgaauagguuugcuccauuggaaucccucaaggucgaagucggucaagaggcaagcgaauguauauuuaagaaaccuaaauauacgcgcguuugcaagaaagugaagcgugucacaacgcgcuucguucgugaaaaaguuguucguccuauguguucuagauccccuaugcuauuauuuaagcuuaagaaaauuauuuaugauuugcacuuauauagauuaaggaaacagauuaggauguugagacgucaaaaacagcgcgaguaugaguuagaguguguuacuaguuuguuacaauuaucgaauccggugcaggcaaaaccagagauggauaacccuaauccaggaccugauggcgagggugaagucgaauuagaaaaggauagcaauguuguuuuaacaacucagcgagauccuaguacaucuauuccagcgccggcgagcguaaaauggaguagauggacuaguaaugacguaguagaugauuacgccacaauuacaucucgaugguaccagauugcugaauuuguuuggucgaaggaugauccauuugauaaggaguuagcacguuuaauuuugccucgugcuuuguuaucuaguauagaggcuaauucugaugcuauaugugaugugccuaauacuaucccauuuaagguacacgcauauuggcguggcgauauggaaguuagaauucaaauuaauucaaauaaauuccaaguuggucaauuacaagcuaccugguauuauugggaucaugagaauuugaauauaucgucuaagagaagcguuuauggauuuucacaaauggaucacgcuuugauuagugcgucagcaaguaaugaagcaaaauuaauuauuccauauaagcauguuuauccauuuuuaccaacaagaauugugccagauuggacuacuggcauuuuagauaugggugcuuugaacauucguguaaucgcucccuuacggaugagugcuacugguccaacuaccuguaauguuguuguguuuauuaaauuaaauaacagcgaguuuacagggacuucuucugguaaguuuuauacgacccaaaucagggcaaaaccugagauggaucguauauuaaauuuagcagagggauuguugaauaacacgauuggugguaauaauauggauaauccuucuuaucaacaaucuccucgucauuuugucccgacugguaugcacagcuuagcuuuagguacuaauuuaguugagccauuacaugcauuacguuuggaugcagcugguacgacacaacauccuguagguugugcuccugaugaagauaugacuguaucuuccauugcaucucgauauggacuaauuagacggguacaauggaagaaagaucaugcuaaaggaucacuuuuguuacaguuagaugcugauccauuuguggagcaaaaaauugaagguacgaauccaauaucuuuguauugguucgcacccguggguguagugucuaguauguuuaugcaauggcguggugcauuagaauauagguuugauauuauagcaucccaauuucauacuggcagguuaauugucgguuaugugccugguuugacagcaucuuugcaacuucaaauggauuauaugaaacugaagucaucgaguuauguaguguuugauuuacaagaaaguaauagcuucacuuuugaggugccuuauguuucauauagaccauggugggugcguaaauaugguggcaauuaucuacccucgucaacugacgcuccuaguacauuauuuauguaugugcagguuccguugauaccuauggaagcuguuucagauacuauugacaucaauguguacguacggggcgguaguucauuugaaguuuguguuccgguccagccuaguuuggguuugaauuggaauacagacuuuauuuuacguaaugacgaagaauacagggccaagacagguuaugcaccauauuaugcuggaguguggcauagcuucaauaauaguaauucucuuguuuuuagguggggaucugcuucugaucaaauugcucaguggccgacaauuucaguaccaagaggugagcuagcuuucuuacgaauuaaggacggaaagaaagcugcuguaggaacucaaccuuggcguucgaugguuguuuggccuucuggucauggcuauaauauugguauaccuacguauaaugcugaacgagcucgccagcuugcacaacacuuauauggugguggaucauuaacugaugagaaggccaaacaauuauuuguuccugcuaaucaacaaggaccugguaagguaaguaauggaaauccgguaugggaagucaugcgugcaccauuggcaacacagcgugcgcauguucaagauuuugaauuuauugaagcuauuccagaaggagaggagucucguaauacuacagucuuggauacgaccacuacuuuacagucgaguggauuuggucgcgccuucuuuggagaagcuuuuaaugaucuuaaaacguuaaugcgacgauaucaauuauauggucaauuauuauuguccguuacuacggauaaggauauugaucauuguauguuuaccuucccuuguuuaccacaaggguuagcguuagacauugguucugcuggcucuccacaugaaaucuuuaauagaugucgugaugguauuauaccauuaauugcaucuggauauagauuuuauagaggagauuugcguuauaagauuguuuuuccaaguaauguuaauagcaauauuuggguacaacaucgaccggaucguagacuggaaggaugguccgcggcuaagauuguaaauugcgaugcugugucuacuggucaagggguauauaaucaugguuaugcuagucacauucaaaucacgcguguaaauaauguuauagaauuggaaguuccauuuuauaaugcuacuuguuauaauuauuuacaggcguuuaaugcgucuagcgcugcaucuaguuaugcaguaucuuuaggagaaauaucgguugguuuucaagcuacaagugaugauauugcaucuauuguuaacaaaccuguuacuauuuauuauaguauuggagaugguaugcaauuuucucaguggguuggauaucaaccgaugaugauccuagaccagcuuccugcaccaguaguaagggccgugccugagggcccuauugcgaagauuaaaaacuucuuccaucaaacaaccgacgaaguuagagaagcucaggcagcaaagaugcgugaagauauggguaugguuguccaagauguuauuggagaaguuacccaggccauaccggaucuucaacaacuggagguucaaacaaaugucuuuucacuggugucuccguuagugcaugccguuauggguacuaguuugaagacgguugcuugggcgauuguuucgauuuuugugacuuuaggauuaauuggacgcgaaaugaugcauucaguuauuacuguagucaagcgguaacuugagaaauaucacuuggcgacgcaacccccggaauccgccagcucaaguacuguuauaucugccguuccaaaagcucccaaugcugaagcggaagaggcaagugcuuggguguccguuauuuauaauggcgcguguaauaugcuuaauguggcugcucaaaaaccgaaacaauuuaaagauuggguaaaauuagcuacgguggauuuuaguaauaauuguacagguaguaaccagguauuuguauuuuucaagaauucuuuugaaguguugaagaaaaugggggguuauguauuuugucagaguaauccugcagcgcguuuguugaaagcugagaaugacaagccugagauuuuaaaaucaugguugaaggaaugucucucuuuggaugaucacaauuugagauugcgucgagcgcaugaucaagaguauaucgagagaguguuugcggcacauucauauggacaaauuuugcuacaugauuuaacugcugaaaugaaucaaucacgaaauuugaguguguuuacacguguguaugaucaaauuucaaaauugaagacugaucuuauggaaaugggaucgaauccauauauaaggcgugaauguuuuacgauaugcauguguggugcaucuggaauuggaaaaucauauuugaccgauucuuuaugcagcgagcucuuacgugcgagucguacuccugugacaacaggcauaaaaugcguuguuaauccauuaucugauuauugggaucaaugcgauuuucagccuguuuugugcguugaugacauguggaguguugaaacaucuacuacgcucgauaagcaguugaauaugcuuuuccagguucauuccccuaucgugcuuucuccuccuaaagcugauuuagaagguaagaaaaugcgauauaacccggaaauauucauauacaauacgaauaaaccuuuuccgagguuugaucguauugcuauggaagcuauuuaucggcguagaaauguuuugauugaauguaaagcgagugaagagaagaagcgaggauguaagcauugugagaaugauauuccuauugcugaauguaguccuaagauguugaaagauuuucaucauauuaaauuuagguaugcacaugauguauguaauuccgagaccacauggucugaauggaugacguauaaugaauuucuugaauggauaacuccuguguauauggcuaaucgucguaaggcgaaugaaucguuuaagaugcguguggaugaaaugcaaauguuacguauggaugaaccauuggaaggugauaauauccucaauaaguauguugaaguuaaucagcgcuuaguggaggaaaugaaggcauuuaaggagcguacacuauggucagauuuacaucgcguaggugcggaaauuagugcgucaguuaagaaagcuuuaccaaccauuuccauaaccgaaaaacuaccacauuggacuguucaaugugguauugcuaaaccugagauggaccaugcuuaugagguuaugaguucguaugcagcuggaaugaaugcagagauugaagcgcaugaacaaguucggcuuucaucaguagaaugucaauaugcagagccucaagcuccaagaaacucugaugaugaaggaccaaccauagaugaagaacuuaugggcgacacugaauuuacaucacaggcucuagaacgucuuguggaugaagguuauauaacuggaaaacagaagaaauauauggcuaugugguguaguaagcgucgugaacauacugccgacuuugaucuuguguggacugauaauuugcguguguuaagugcguaugcgcaugaucgcucaucuucaacucggcuuucuacggaugaugucaaguuauauaaaacaauuagcauguuacaucaaaaguaugauacuacagagugugcuaaaugucaacauugguaugcuccguugacugacaucuauguugaugauaagaaauuguucuggugucagaaagagacaaagacacuuauugauguccgcaaauugucgaaagaagaugugacuguucaaucaaaauugauuaacuuaucuguuccuuguggugaaguguguauguuacauucaaaauauuucaauuaucuuuuccauaaagcaugguuguuugagaacccgacuuggcgccuaauauauaaugguaccaagaaggguaugccugaguacuuuaugaauuguguggaugaaauuucauuagauuccaaauuugguaaagugaaaguaugguugcaagcgauuauugacaaguauuuaacucgucccgugaaaaugauucgugauuuucuuuucaagugguggccgcaaguugcguauguguugagcuugcuagguauaauugguauaacugcguaugaaaugagaaauccgaaaccaacuucugaggaacuagcugaucauuaugugaauaggcauuguagcucagauuuuuggucaccaggacuggcaucaccucaaggauugaaauauagugaagcaguaacaguaaaggcgccaagaauccauagauugccaguuacuacuaagccucaaggaucaacacaacaaguagacgcugcugugaauaagauucuacagaacaugguuuauauugguguuguuuucccaaaagugccugguaguaaguggcgagauauuaauuuuaggugucuuaugcuucauaauaggcaauguuuaauguugaggcauuauauugagucaacugcugccuuuccugagggaaccaaguacuauuuuaaguauauucauaaucaagagacuagaaugucuggugauauuucugguauugaaauugauuuguugaauuuaccuagauuguauuaugguggucucgcgggagaggagucguuugauaguaauaucgugcuugugacuaugccuaaucguauuccugaguguaagagcauuauuaaauuuauagcgucacauaaugagcauauacgugcucagaaugauggaguguuaguaacuggcgaccauacucagcuauuggcuuucgagaauaauaauaaaacuccaauaaguaucaaugcugaugguuuguaugagguuauacuucaaggaguauauacuuauccauaccauggcgaugguguuugugguucgauauuguuaucucggaauuuacaacggccaauuauagguauccauguugcugguacugaaggauugcauggcuuuggaguugcugaaccacuuguacaugaaauguucacugguaaagcaaucgagagugaaagagagccguaugaucguguguaugaacuuccguugcgugaauuagaugaaucugauauugguuuagauaccgauuuauauccgauugguagaguggaugcaaagcuagcucaugcucaaagcccuucuacugggauuaaaaagacgcuuauccauggaacauuugauguaaggacugaaccaaacccgaugucaucacgugauccaagaauagcgccgcacgauccuuugaaguuagggugugaaaagcauggcaugcccuguucaccguuuaauaggaaacaucuggaauuagcgacaaaucauuugaaagaaaaauuaguuucaguaguuaaaccaauaaaugguugcaagauuagaaguuugcaagaugcuguauguggugugccuggauuagauggguuugauucgauaucuuggaauacuagugcugguuuuccuuuaucuucauuaaagccaccuggaacaucagguaagcgaugguuguuugacauugagcuacaagauucgggauguuaucuccugcguggaaugcgucccgaacuugagauucaauuaucaacgacacaguuaaugaggaaaaagggaauaaaaccucacacuauauucacggauuguuugaaagauacuuguuugccuguggaaaaauguagaauaccugguaagacuagaauauuuaguauaaguccgguacaguuuaccauaccguuucgacaguauuauuuagacuuuauggcauccuaucgagcugcacgacuuaaugcugagcaugguauugguauugauguuaacagcuuagaguggacaacuuuggcaacaagguugucuaaguauggcacucacaucgugacaggagacuauaagaauuuugguccuggguuagauuccgauguugcagcuucagcguucgaaauuauuaucgacuggguauuacauuacaccgaagaagauaauaaagacgaaaugaagcgaguaauguggaccauggcgcaagagaucuuagcgccuagucaucuauaucgugacuugguguaccgaguaccuugcggaauuccaucagguucuccaauaacggacauauugaauacaauuucaaauuguuuguuaauuagguuagcuugguuagguauuacugauuugccuuuguccgaguucucucaaaauguuguucuugucuguuauggcgaugaucuuaucaugaauguuagcgauaauaugauugauaaguuuaacgccgugacgauaggaaaauucuuuucacaauauaagauggaauuuacggaucaggauaaaucaggaaauacuguaaaguggcggacgucauggcuuuggaguugcugaaccacuuguacaugaaauguucaccgguaaagcaaucgagagugaaagagagccguaugaucguguguaugaacuuccguugcgugaauuagaugaaucugauauugguuuagauacugauuuauauccgauugguagaguggaugcaaagcuagcucaugcucaaagcccuucuacugggauuaaaaagacgcuuauccauggaacauuugauguaaggacugaaccaaauccgaugucaucacgugauccaagaauagcgccgcaugauccuuugaaguuagggugugaaaagcauggcaugccuuguucaccguuuaauaggaaacaucuggaauuagcgacaaaucauuugaaagaaaaauuaguuucaguaguuaaaccaauaaaugguugcaagauuagaaguuugcaagaugcuguauguggugugccugguuuagauggguuugauucgauaucuuggaauacuagugcugguuuuccuuugucuucauuaaagccaccuggaacaucagguaagcgaugguuguuugacauugagcuacaagacucgggauguuaucuccugcguggaaugcgucccgaacuugagauucaauuaucaacgacgcaguuaaugaggaaaaagggaauaaaaccucacacuauauucacggauuguuugaaagauacuuguuugccuguugaaaaauguagaauaccugguaagacuagaauauuuaguauaaguccuguacaguuuaccauaccguuucgacaguauuacuuagacuuuauggcauccuaucgagcugcacgacuuaaugcugagcaugguauugguauugauguuaacagcuuagaguggacaaauuuggcaacaaguuugucuaaguauggcacucacaucgugacaggagacuauaagaauuuugguccuggguuagauuccgauguugcagcuucagcguucgaaauuauuaucgacuggguauuacauuacaccgaagaagauaauaaagaugaaaugaagcgaguaauguggaccauggcgcaagagaucuuagcgccuagucaucuaugucgcgacuugguguaccgaguaccuuguggaauuccaucagguucuccaauaacggacauauugaauacaauuucaaauuguuuguuaauuagguuagcuugguuagguauuacugacuuaccuuuguccgaguucucucaaaauguuguucuugucuguuauggcgacgaucuuauuaugaauguuagcgauaauaugauugauaaguuuaaugccgugacgauaggaaaauucuuuucacaauauaagauggaauuuacggaucaggauaaaucaggaaauaccguaaaguggcggacguuacagacugcuacuuucuuaaaacauggguuuuuaaaacauccaacuagaccuguguuuuuagcuaaccuggauaaggucucgguagaaggaacgacgaauuggacucaugcucgaggauugggucgucguacagcaaccauagagaaugcuaaacaagcgcuagaguuagcauucggaugggguccagaauacuuuaacuaugucagaaauacuaucaaaauggcuuuugacaaguuggguauuuaugaagaccuuaucacuugggaggaaauggauguuagauguuaugcuagcgcguaguauuuaauuuugaauacucauuaguuuuaauuuuauuuuagguuauuggaauugagggaaguaccaccccccaagaccuucguuuuaaaucuacuaaaaggagugaaccuauauauaagagucuaaaaacagaguggauuagaccaccauuu

Zainteresowany? Subskrybuj, aby dostawać nowości na mejla
Get This Widget