Menu

Wirus - życie czy nie?

Celem poniższej pracy jest próba pochylenia się nad problemem, jakim jest uznanie przynależności wirusów do świata ożywionego. Temat ten wciąż jest przedmiotem wielu naukowych sporów, ponieważ dotyczy dwóch niezwykle ważnych dla współczesnej nauki kwestii, które wciąż nie doczekały się rozwiązania: gdzie leży granica między systemem biologicznym i abiologicznym oraz w jaki sposób należy zakwalifikować biologiczne układy bezkomórkowe (wirusy, wirioidy i priony) aby przedstawić ich powiązanie z ewolucją życia na Ziemi?

Widoczne wiriony wirusa przez mikroskop
Wiriony pod mikroskopem elektronowym szczepu B HBV wirusowego zapalenia wątroby, fot: Microbe World

W zależności od przedstawionych wyjaśnień wirusy można postrzegać jako wyspecjalizowane, zredukowane do minimum pasożyty wewnątrzkomórkowe lub jako niezwykle złożone efekty uboczne zjawiska horyzontalnego transferu genów. Jednak, aby móc zastanowić się nad tym, czy uznanie istnienia ,,czwartej domeny” ma sens (obok eukariontów, prokariontów i archeonów) należy najpierw przyjrzeć się współczesnym sposobom definiowania podstawowego przedmiotu badań nauk biologicznych.

W przeciwieństwie do przednaukowych założeń o nadnaturalnych przyczynach istnienia życia oraz koncepcji witalizmu - zakładającej, że różnica między materią ożywioną, a nieożywioną ma charakter jakościowy zaś fizykochemiczny opis jest niewyczerpujący - obecnie żaden przedstawiciel nauk ścisłych nie ma wątpliwości, że życie, choć jest systemem emergentnym, podlega takim samym prawom fizyki i chemii jak materia nieożywiona. Z tego powodu można badać je tak samo jak środowisko abiotyczne. Dzięki wyłączeniu czynnika transcendentalnego biologia mogła stać się nauką w pełni empiryczną i eksperymentalną, bez czego nie byłby możliwy rozwój takich nauk jak biotechnologia, biologia molekularna lub biomedycyna. Mimo niezaprzeczalnych osiągnięć, wciąż podanie spójnej i uniwersalnej definicji życia wydaje się, zdaniem niektórych badaczy niezwykle trudnym zadaniem, ponieważ niemal zawsze w biologii można natknąć się na wyjątek od reguły.

Życie podlega takim samym prawom fizyki i chemii jak materia nieożywiona

Za najprostszą definicję życia można uznać zdanie Tibora Gánti, węgierskiego biologa i biochemika, a zarazem twórcy teorii chemotonu „system wykazujący permanentną wymianą materii i energii między żywym organizmem a jego otoczeniem, zdolny do utrzymywania homeostazy, rozmnażania się i dziedziczenia cech osobnika rodzicielskiego przez osobniki potomne”. Tibor Gánti przedstawił osiem podstawowych warunków jakie powinien wykazywać system złożony, aby mógł zostać zakwalifikowany jako organizm: musi być odgraniczony od środowiska, posiadać przemianę materii, utrzymywać homeostazę, posiadać system zapisu i odczytu danych, być wyposażony z system samoregulacji, być zdolny do wzrostu, wykazywać śmiertelność oraz ulegać podziałowi w momencie którego zachodzą procesy których skutkiem jest zmienność. Z kolei inny wybitny umysł XX wieku Erwin Schrödinger w swoim krótkim eseju zatytułowanym: ,,Czym jest życie? Fizyczne aspekty żywej komórki” przedstawił życie jako ciekłokrystaliczny materiał o właściwościach analogicznych do ferromagnetyka lub nadprzewodnika, który utrzymuje niewiarygodnie niski poziom entropii1 wewnętrznej poprzez jej zwiększanie w swoim otoczeniu. Należy pamiętać, że były to czasy zanim prawa genetyki oraz rola DNA w procesie dziedziczenia zostały opisane.

Fizyk teoretyczny Freeman Dyson, Amerykanin brytyjskiego pochodzenia, przedstawił swoje własne wyjaśnienie zjawiska biogenezy, jako nałożenia się na siebie dwóch pierwotnie niezależnych procesów chemicznych: replikacji i metabolizmu. Zgodnie z tym modelem aparat metaboliczny stał się źródłem zasilania i substratów dla replikatora, zaś cząsteczka dzieląca się na skutek integracji utrwaliła w swojej strukturze informację o właściwościach i składzie chemicznym molekularnego „akumulatora”, dzięki czemu mógł być odbudowywany przy każdym następnym podziale. Według definicji Dysona metabolizm i replikacja są jakby dwiema stronami tego samego medalu i tylko jako jedność mogą stanowić system żywy. Z kolei dla geochemika z należącego do NASA Jet Propulsion Laboratory Michaela Russella, najistotniejszą właściwością żywego organizmu jest wykorzystywanie pobranej z otoczenia energii do polimeryzacji związków organicznych. Zapytany, co w jego opinii jest istotą życia odpowiedział: ,,To proste. Celem życia jest uwodornianie dwutlenku węgla”. Nick Lane, inny uczony, biochemik pracujący na wydziale Genetyki, Ewolucji i Środowiska na University College London za początek życia uznaje pojawienie się w zupie pierwotnej pęcherzyka fosfolipidowego obdarzonego polaryzacją. Wraz z gradientem elektrochemicznym i różnicą w warunkach elektrochemicznych między środowiskiem we wnętrzu i na zewnątrz błony doszło do powstania procesów permanentnie odtwarzających różnice potencjałów. Według tej definicji proces replikacji jest skutkiem aktywności elektrochemicznej, gdyż zbyt duże napięcie w poprzek błony komórkowej, powodowało rozszerzanie się protokomórki, a w efekcie jej podział na dwa pomniejsze pęcherzyki błonowe. Przetrwały tylko te, które ,,nauczyły się” kodować na zgromadzonych w swoim wnętrzu cząsteczkach instrukcje pozwalającą utrzymywać gradient elektrochemiczny i przywracać go, jeżeli na skutek zmian w środowisku został utracony.

Otwarte ramki odczytu wirusa
Geny wirusa DWV (pszczeli wirus zdeformowanych skrzydeł) typu A oraz jego wiriony w mikroskopie elektronowym

Wyjątkowo niekonwencjonalną, uznaną przez większość naukowców zajmujących się biogenezą za kontrowersyjną, definicję życia przedstawił Jim Al.-Khalili, szef katedry fizyki teoretycznej na Uniwersytecie w Surrey. Jim Al.-Khalili prowadził badania z zakresu mechaniki kwantowej, na których podstawie doszedł on do wniosku, że pierwszy organizm oznaczony skrótem B.U.L (Basic Unit of Life) jest efektem podtrzymywania splątanego stanu kwantowego w cytoplazmie odseparowanej od szumu otoczenia za pośrednictwem struktur takich jak błona biologiczna, otoczka śluzowa, lub ściana komórkowa. Za jeden z dowodów przemawiających za tą hipotezą uznaje on nietypową budowMicrobe Worldę błon komórkowych występujących u archeonów. W przeciwieństwie do dwóch pozostałych domen świata ożywionego błona komórkowa archeonów nie jest dwuwarstwą lecz monowarstwą, która opiera się na wiązaniach eterowych w kwasach tłuszczowych zamiast na estrowych, jak u innych form życia. Istnienie eterowej monowarstwy ma wynikać z potrzeby zabezpieczenia kwantowej synchronizacji, której efektem są wszystkie zjawiska biologiczne. Większość środowiska naukowego jest jednak zdania, że brak obecnie wystarczających dowodów, aby za istotę aktywności biologicznej uznać utrwalanie sieci kwantowych splątań.

Stuart Kauffman, emerytowany profesor biochemii na Uniwersytecie w Pensylwanii, współtwórca biologii systemów, upatruje przyczyn istnienia życia nie w sprzężeniu stanów kwantowych, lecz w utrzymywaniu w pojedynczej komórce obwodu złożonego z wiązań wodorowych, w obrębie których zachodzi ciągła wymiana kationów wodorowych. Tym samym bezpośrednią przyczyną biogenezy byłyby spontanicznie powstające układy supramolekularne, których samoorganizacja wynikałaby z właściwości wiązań2 wodorowych ulegających w sposób ciągły zerwaniu jak i odbudowie w najkorzystniejszy z punktu widzenia energetycznego kształt cząsteczki.

Niezwykle prostą, a równocześnie uniwersalną definicję, nazwaną cybernetyczną przedstawił polski profesor biotechnologii z Uniwersytetu Jagiellońskiego, Bernard Korzeniewski. Brzmi ona: ,,Życie to system sprzężeń zwrotnych ujemnych podporządkowanych nadrzędnemu sprzężeniu zwrotnemu dodatniemu”. Zakłada on, że najprostszym modelem życia jest samoregulujący się termostat zdolny do samodzielnego pobierania energii i części zamiennych ze swojego otoczenia.

Wszystkie powyższe próby opisania życia kładą nacisk na występowanie stanu dynamicznej równowagi podtrzymywanej przez ten system. Różnice między nimi wynikają z odmiennych poglądów na temat przyczyn i mechanizmu tego procesu. W opozycji do nich można zaprezentować wyjaśnienia redukcjonistyczne, uznające za kluczowy proces replikacji, zaś metabolizm spychające do roli źródła zasilania dla replikatora. Najbardziej znanym przedstawicielem tego nurtu jest popularyzator nauki, przedstawiciel neoateizmu i krytyk szeroko rozumianego religijnego myślenia Richard Dawkins. W swojej słynnej popularnonaukowej książce ,,Samolubny Gen” przedstawił koncepcję, według której organizmy są tylko inkubatorami, dla kodujących informację o ich budowie genach. Chcąc zawęzić poglądy przedstawione w tej publikacji do pojedynczego zdania można sformułować je tak: ,,Życie to zbiór autonomicznych replikatorów zdolnych do ewolucji.” Zgodnie z tą definicją formami życia są również systemy i zjawiska nieuznawane za część świata ożywionego. Sam Richard Dawkins jest autorem hipotezy istnienia memu. Mem jest to skrót od wyrażenia: memory’s gen, czyli gen pamięci. Według niej przekaz kulturowy wykazuje wiele cech wspólnych z przepływem genów, a umysł i behawior jest jakby tym dla owych replikatorów, czym komórki dla genów. Sam Richard Dawkins oficjalnie manifestując swoją wrogość wobec religii często porównuje je do wirusów, a uznawanie jego zdaniem niedorzecznych dogmatów sprzecznych z wiedzą naukową za efekt działania ,,wirusa wiary”. Paradoksalnie zgodnie z modelem memetyki ideologie są w kulturze tym, czym wirusy w środowisku naturalnym. Oznacza to, że zdaniem zwolenników tej hipotezy myśli i rytuały też w pewnym sensie są ,,organizmami”.

Zapoznając się z różnymi sposobami wyjaśnienia czym jest to niezwykłe zjawisko, którego jesteśmy nieodłączną częścią, możemy powrócić to tematu przewodniego, czyli próby zaklasyfikowania wirusów jako form życia, lub tylko produktu jego aktywności. Zanim przejdziemy do argumentacji na rzecz obydwu opinii, warto przedstawić obecne poglądy na temat filogenetyki wirusów, ponieważ jest ona ściśle związana z tym, czy istotniejszy jest metabolizm, czy też replikacja. Zdaniem jednej z nich wirusy pochodzą od organizmów pasożytniczych, które na drodze doboru naturalnego uległy daleko idącej redukcji, pozbywając się organelli, cytoplazmy oraz własnego metabolizmu kodując w swoim materiale genetycznym mechanizmy pozwalające przejmować metabolizm żywiciela. Uwalniany do otoczenia kapsyd według tej hipotezy jest zredukowanym przetrwalnikiem uaktywniającym się w cytoplazmie. Wirus więc wraca do życia tylko kiedy wchodzi w interakcję z transkrypcyjną i translacyjną molekularną maszynerią gospodarza. 

Wirusy posiadające cechy zbliżające je do komórek

Wirusolodzy postrzegający wiriony, czyli pojedyncze cząsteczki wirusa jako wyspecjalizowane endospory w dużej mierze bazują na odkryciu tzw.: mimiwirusów, zwanych też super wirusami. Owe nietypowe organiczne struktury odkryto w roku 1992 w przemysłowej wieży chłodniczej w Bradford. Początkowo ze względu na swoje rozmiary, złożoność genomu oraz posiadanie wielowarstwowej błony komórkowej zostały uznane za bakterie3 pasożytujące na amebach. Dopiero kolejne badania wskazujące na brak rybosomów, jak i znajdywanie kolejnych ,,bakteriomorfów” choćby na lodowych pustyniach Antarktydy, pozwoliły udowodnić, że są to niezwykle złożone wirusy posiadające cechy zbliżające je do komórek, jednak tylko pod względem strukturalnym, a nie funkcjonalnym. Należy jednak zwrócić uwagę na fakt, że znacznie popularniejsza jest hipoteza zgodnie z którą początków istnienia wirusów należy dopatrywać się w horyzontalnym przekazie genów za pośrednictwem plazmidów. Plazmidy są to niewielkie, koliste cząsteczki DNA umożliwiające organizmom prokariotycznym oraz archeonom (rzadziej eukariontom) proces transformacji, czyli nabywania nowych genetycznych cech bez potrzeby koniugacji. Dzięki temu organizm może zyskać biokatalizatory, które np.: pozwalają bakterii na zyskanie oporności na konkretny szczep antybiotyków. Wystarczy jednak, że pewna część plazmidów jest niefunkcjonalna, ponieważ po wniknięciu do cytoplazmy zaburza metabolizm i indukuje produkcję tylko własnych kopii, nie przynosząc korzyści biorcy. Ponieważ komórki biorców starały się zwalczać zakłócające ich pracę plazmidy dokonywały ich selekcji naturalnej, na skutek której w obiegu pozostały tylko niefunkcjonalne plazmidy, zdolne do przetrwania w niekorzystnym środowisku zewnętrznym, jak również uniknięcia wykrycia i dezaktywacji przez wyspecjalizowane systemy wewnątrzkomórkowe. Można więc stwierdzić, że powstanie wirusów to konsekwencja wyodrębnienia się procesu transdukcji z procesu transformacji. Oba procesy znalazły szerokie zastosowanie w biotechnologii do otrzymywania organizmów transgenicznych. W przypadku transformacji wektorem przenoszącym informację genetyczną jest plazmid, zaś w procesie transdukcji rolę plazmidu pełni wirion. Ostatnio coraz popularniejszą metodą edycji genów, która może w przyszłości posłużyć do wykonywania terapii genowych jest technika CRISPR. Polega ona na wykorzystaniu mechanizmu wykrywania i wycinania wirusów o nazwie Cas9, pozwalający komórkom na uniknięcie roli żywiciela.

Grafika struktury białka
Jedno z białek kodowanych przez gen wirusa DWV

Zwolennicy pierwszej hipotezy są zdania, że wirusy należy zaklasyfikować jako przedstawicieli tzw.: życia bezkomórkowego. Natomiast pozostali naukowcy przekonują, że wirusy są zbyt prostymi jednostkami aby móc uznać je za pełnoprawne organizmy. Ponieważ znacznie więcej argumentów przemawia za zanegowaniem przynależności wirusów do świata ożywionego, należy zacząć od przedstawienia argumentów falsyfikujących najpowszechniejszy pogląd na ten problem. Jakie więc właściwości posiadają wirusy, które pozwoliłyby za utworzenie z nich czwartej domeny życia na Ziemi? Oczywiście za podstawową cechę uważa się zdolność do powielania się z drobnymi błędami pozwalającymi im nabywać nowe właściwości zwiększające adaptację do pasożytnictwa wewnątrzkomórkowego. Ponadto wirusy oparte są na tym samym kodzie genetycznym co wszystkie formy życia. Są zdolne do transkrypcji, translacji a ostatecznie uwolnienia się komórki gospodarza. Potrafią zakłócać wewnątrz cytoplazmatyczne mechanizmy w taki sposób, aby umożliwić proces składania własnych otoczek białkowych. Wirusy podlegają prawom klasyfikacji taksonomicznej zgodnej z zasadami przyjętymi przez Karola Linneusza. Można układać na podstawie ich materiału genetycznego drzewa filogenetyczne na bazie których można określać ich wzajemne pokrewieństwo.

Najistotniejszą właściwością wirusów sugerującą, że są niezwykle prostą, ale mimo wszystko formą życia, jest ich zdolność do wykrywania potencjalnych zagrożeń, jakie mogą doprowadzić do obumarcia ich żywiciela. Poprzez nie do końca jeszcze poznane mechanizmy wirus przechodzi z formy utajonej na aktywną, jeżeli wykryje, że gospodarz ma niewystarczającą ilość pożywienia lub, że jest otoczony innymi organizmami, które mogłyby zostać potencjalnymi nosicielami. Potwierdza to niedawno4 dokonane odkrycie sugerujące, że wirusy wykrywają zagęszczenie innych organizmów w pobliżu zainfekowanej komórki. Dzięki temu z punktu widzenia ewolucji mają możliwość wydostania się gdy w okolicy są inni potencjalni żywiciele. Jednak na tym kończą się argumenty na podstawie których można wyciągnąć wniosek o wykazywaniu przez systemy wirusowe właściwości układów żywych. Argumentację na rzecz przeciwnej tezy należy zacząć od podstawowego faktu, że w przeciwieństwie do trzech domen życia wirusy ulegają procesowi namnażania, a nie rozmnażania. To bardzo istotna różnica. Nie mamy tu bowiem podziału komórkowego prowadzącego do powstania dwóch komórek potomnych z pojedynczej rodzicielskiej lecz produkcję milionów kopii na podstawie wirionu modelowego na molekularnej taśmie produkcyjnej. Poza granicami komórki żywiciela wirusy nie wykazują jakichkolwiek cech właściwych organizmom. Poza konstrukcją białkowego kapsydu nie posiadają wydzielonej ze środowiska przestrzeni wewnętrznej. Nie są zdolne do wzrostu, ani nie zmieniają się pod wpływem otoczenia

Retro: DWV, HIV i SARS-Cov2

Każdy nowo utworzony wirion jest już w pełni ,,dojrzały” do znalezienia sobie gospodarza. Obecne badania sugerują, niezdolność wirusów do jakiegokolwiek ruchu aktywnego. Oznacza to, że nie mogą czynnie poszukiwać komórek, aby do nich wniknąć w sposób analogiczny jak gamety męskie lub endobakterie. Istotną kwestią jest fakt, że do czynnej infekcji (po adsorpcji do komórki) zdolne są tylko bakteriofagi i wirusy komórek zwierzęcych. Wirusy roślinne (np. wirus mozaiki tytoniowej) jak i wirusy grzybów, nie są zdolne dostać się do cytoplazmy bez obecności mechanicznych uszkodzeń ściany komórkowej. Wirus nie wymienia energii ani materii ze swoim otoczeniem oraz oczywiście jest niezdolny do reakcji na bodźce. Niektóre wirusy zwierzęce posiadają otoczkę fosfolipidową zawierającą receptory ułatwiające wniknięcie do komórki lecz nie jest ona ich wytworem, a jedynie formą płaszcza ochronnego, który otacza je na skutek procesu egzocytozy. Pojedynczy wirion nie posiada też wieku biologicznego, przez co nie wykazuje oznak starzenia się, a proces unieszkodliwienia go przebiega w identyczny sposób jak denaturacja białek i polega na odkształceniu jego wyższych struktur. Niektóre wirusy są w gruncie rzeczy pojedynczymi cząsteczkami ulegającymi procesowi krystalizacji, który w żaden sposób nie wpływa na ich wirulentność, czyli potencjał infekcyjny. Nie wszystkie wirusy mają nawet materiał genetyczny w postaci DNA lecz często jest nim RNA. Noszą wtedy nazwę retrowirusów. Do tej grupy należy wirus DWV, HIV i SARS-Cov2. Ze względu na to, że RNA jest bardziej niestabilny od DNA, a przepisująca informację z RNA na DNA odwrotna transkryptaza popełnia wiele błędów retrowirusy są bardzo zmienne i niezwykle trudne jest wytworzenie inaktywujących je przeciwciał. Nie można zapominać o fakcie, że technicznie rzecz biorąc nie są wcale autonomicznymi replikatorami, ponieważ potrzebują niezwykle skomplikowanego aparatu enzymatycznego służącego replikacji materiału genetycznego infekowanych przez nie organizmów. Oznacza to, że przy braku w ich otoczeniu żywych komórek wirus zachowuje właściwości złożonych polimerów i nic nie wskazuje na jego żywą naturę. Ostatni argument warty przytoczenia świadczący za tym, że uznanie wirusów za czwartą domenę życia nie znajduje uzasadnienia jest możliwość abiotycznej syntezy całych wirionów na identycznych zasadach jak genoforów bakteryjnych i plazmidów. Wyprodukowane na drodze chemicznej biopolimery nie różnią się jakościowo od tych syntetyzowanych w komórkach. Fakt sprawia, że bliżej im do molekularnych automatów, niż najprostszych aktywnych biochemicznie systemów komórkowych, które wciąż pozostają poza zasięgiem chemicznej syntezy.5

Wirusy nie powinny zostać uznane za autonomiczne formy życia

Reasumując, wirusy nie powinny zostać uznane za autonomiczne formy życia. Nie tylko dla tego, że nie mają struktury komórkowej, ani aparatu metabolicznego lecz ze względu na konsekwencje jakie niosłoby ich włączenie do filogenetycznego drzewa życia. Obecne definicje życia są stosunkowo niejednoznaczne. Mimo wszystko jesteśmy w stanie postawić w miarę określoną granicę miedzy tym co żywe, a tym co nieożywione. Uznanie za żywe, tak prostych układów jak wirusy, oznaczałoby zburzenie tej granicy, w pewnym sensie powrót do myśli o samorództwie. Zgodnie z zasadą brzytwy Ockhama w nauce należy zawsze wybierać najmniej skomplikowane wyjaśnienie. Natomiast nadanie wirusom miana form życia skomplikowałby tylko i tak niepełne definicje życia. Powodem tego jest fakt występowania wielu systemów, które pod względem działania zachowują się jak wirusy. Aby zachować konsekwencję należałoby je również określić mianem organizmów. Przede wszystkim pojedyncze geny, plazmidy, a także pojedyncze sekwencje syntetyzowane metodą PCR, musiałyby zostać rozpatrzone jako niezależne formy życia. Również ludzkie idee, czy przekazywane w społeczeństwie wartości, a nawet wiedza o projektowaniu konkretnych narzędzi i urządzeń zostałyby potencjalnie zakwalifikowane jak organizmy o bliżej nieokreślonej naturze. Przede wszystkim jednak pod znakiem zapytania stanęłyby wytwory technologii i elektroniki, zaczynając od wirusów komputerowych, a kończąc na zdalnie sterowanych taśmach produkcyjnych, zdolnych na podstawie dostarczonego im układu scalonego produkować niezliczoną ilość jego kopii. Tym samym uznanie wirusów za organizmy wiązałoby się z utworzeniem jeszcze piątego królestwa: urządzeń elektronicznych zdolnych do taśmowej produkcji własnych części i kopii na podstawie odczytu danych zapisanych we własnej strukturze.

Kacper Jerzy Piwowarek (Wydział Antropozoologii Kolegium Artes Liberales) 

Bibliografia:

  1. Al-Khalili J. Życie Na Krawędzi Era Kwantowej Biologii wyd. Prószyński i S-Ka Warszawa 2016
  2. Brooks M. 13 Rzeczy które nie mają Sensu wyd. Literackie Warszawa 2011
  3. Carroll S. Nowa Perspektywa; Pochodzenie Życia, Świadomości i Wszechświata wyd. Prószyński i S-Ka Warszawa 2017
  4. Clancy P. W Poszukiwaniu Życia Badania Układu Słonecznego wyd. Prószyński i S-Ka Warszawa 2008
  5. Dawkins R. Samolubny Gen wyd. Prószyński i S-Ka Warszawa 2012
  6. Doudna J.A. Edycja Genów Władza Nad Ewolucją wyd. Prószyński i S-Ka Warszawa 2018
  7. Dyson G. Darwin wśród maszyn: rzecz o ewolucji inteligencji wyd. Prószyński i S-Ka Warszawa 2005
  8. Gánti T. Podstawy Życia wyd. Wiedza Powszechna Warszawa 1986
  9. Kofta W. Postawy Inżynierii Genetycznej wyd. Prószyński i S-Ka Warszawa 1999
  10. Konieczny L. Biologia systemów: Strategia działania organizmu żywego wyd. PWN Warszawa 2010
  11. Korzeniewski B. Trzy Ewolucje Ewolucja świata, życia i świadomości wyd. KORONA Kraków 1998
  12. Lane N. Pytanie o Życie; Energia, Ewolucja i Pochodzenie Życia wyd. Prószyński i S-Ka Warszawa 2016

Wykorzystane strony internetowe:

  1. https://kopalniawiedzy.pl/wirus-systematyka-Klosneuwirus,26254
  2. https://kopalniawiedzy.pl/VP882-wirus-bakteria-bakteriofag-quorum-sensing,29279
  3. https://www.focus.pl/artykul/megazagadki-mikroswiata-wirusy-ciagle-zaskakuja-badaczy
  4. http://przystaneknauka.us.edu.pl/artykul/zywe-czy-niezywe-czyli-problem-z-wirusam

 

Cały genom wirusa DWV (pszczeli wirus zdeformowanych skrzydeł) typu A:

auuuuauuuuaaugcugucuuuauugcugauuuauuuugcuguuuuuauuuguuauuuuauauuugcuaauuuucauuauugcgaaauauauugcauugcuauuuuuauuauauacgcuagauucaauuuuauuuuucuuauauuuucaauuuaauuuugauuuugaagguaaauauauauaauuaauuauuaaaaauggccuuuagcugcggaacccuuucuuacucugccgucgcccaagcuccgucuguugcccaugcaccucguacaugggaaguugaugaagcuaggcggcgccgaguuauuaaacguuuggcgcuggagcaagaacguaugcguaacguucuugaugcuagcgucuaugaccaggcaacaugggaacaggaggaugcgcgcgauaaugaguuccuaauggaacaacuaaauaauuuauauacuauuuauucgaucgcugaacgcuguacgcgucggccuaucaaagagcauucuccuauaucaguuucgaauagguuugcuccauuggaaucccucaaggucgaagucggucaagaggcaagcgaauguauauuuaagaaaccuaaauauacgcgcguuugcaagaaagugaagcgugucacaacgcgcuucguucgugaaaaaguuguucguccuauguguucuagauccccuaugcuauuauuuaagcuuaagaaaauuauuuaugauuugcacuuauauagauuaaggaaacagauuaggauguugagacgucaaaaacagcgcgaguaugaguuagaguguguuacuaguuuguuacaauuaucgaauccggugcaggcaaaaccagagauggauaacccuaauccaggaccugauggcgagggugaagucgaauuagaaaaggauagcaauguuguuuuaacaacucagcgagauccuaguacaucuauuccagcgccggcgagcguaaaauggaguagauggacuaguaaugacguaguagaugauuacgccacaauuacaucucgaugguaccagauugcugaauuuguuuggucgaaggaugauccauuugauaaggaguuagcacguuuaauuuugccucgugcuuuguuaucuaguauagaggcuaauucugaugcuauaugugaugugccuaauacuaucccauuuaagguacacgcauauuggcguggcgauauggaaguuagaauucaaauuaauucaaauaaauuccaaguuggucaauuacaagcuaccugguauuauugggaucaugagaauuugaauauaucgucuaagagaagcguuuauggauuuucacaaauggaucacgcuuugauuagugcgucagcaaguaaugaagcaaaauuaauuauuccauauaagcauguuuauccauuuuuaccaacaagaauugugccagauuggacuacuggcauuuuagauaugggugcuuugaacauucguguaaucgcucccuuacggaugagugcuacugguccaacuaccuguaauguuguuguguuuauuaaauuaaauaacagcgaguuuacagggacuucuucugguaaguuuuauacgacccaaaucagggcaaaaccugagauggaucguauauuaaauuuagcagagggauuguugaauaacacgauuggugguaauaauauggauaauccuucuuaucaacaaucuccucgucauuuugucccgacugguaugcacagcuuagcuuuagguacuaauuuaguugagccauuacaugcauuacguuuggaugcagcugguacgacacaacauccuguagguugugcuccugaugaagauaugacuguaucuuccauugcaucucgauauggacuaauuagacggguacaauggaagaaagaucaugcuaaaggaucacuuuuguuacaguuagaugcugauccauuuguggagcaaaaaauugaagguacgaauccaauaucuuuguauugguucgcacccguggguguagugucuaguauguuuaugcaauggcguggugcauuagaauauagguuugauauuauagcaucccaauuucauacuggcagguuaauugucgguuaugugccugguuugacagcaucuuugcaacuucaaauggauuauaugaaacugaagucaucgaguuauguaguguuugauuuacaagaaaguaauagcuucacuuuugaggugccuuauguuucauauagaccauggugggugcguaaauaugguggcaauuaucuacccucgucaacugacgcuccuaguacauuauuuauguaugugcagguuccguugauaccuauggaagcuguuucagauacuauugacaucaauguguacguacggggcgguaguucauuugaaguuuguguuccgguccagccuaguuuggguuugaauuggaauacagacuuuauuuuacguaaugacgaagaauacagggccaagacagguuaugcaccauauuaugcuggaguguggcauagcuucaauaauaguaauucucuuguuuuuagguggggaucugcuucugaucaaauugcucaguggccgacaauuucaguaccaagaggugagcuagcuuucuuacgaauuaaggacggaaagaaagcugcuguaggaacucaaccuuggcguucgaugguuguuuggccuucuggucauggcuauaauauugguauaccuacguauaaugcugaacgagcucgccagcuugcacaacacuuauauggugguggaucauuaacugaugagaaggccaaacaauuauuuguuccugcuaaucaacaaggaccugguaagguaaguaauggaaauccgguaugggaagucaugcgugcaccauuggcaacacagcgugcgcauguucaagauuuugaauuuauugaagcuauuccagaaggagaggagucucguaauacuacagucuuggauacgaccacuacuuuacagucgaguggauuuggucgcgccuucuuuggagaagcuuuuaaugaucuuaaaacguuaaugcgacgauaucaauuauauggucaauuauuauuguccguuacuacggauaaggauauugaucauuguauguuuaccuucccuuguuuaccacaaggguuagcguuagacauugguucugcuggcucuccacaugaaaucuuuaauagaugucgugaugguauuauaccauuaauugcaucuggauauagauuuuauagaggagauuugcguuauaagauuguuuuuccaaguaauguuaauagcaauauuuggguacaacaucgaccggaucguagacuggaaggaugguccgcggcuaagauuguaaauugcgaugcugugucuacuggucaagggguauauaaucaugguuaugcuagucacauucaaaucacgcguguaaauaauguuauagaauuggaaguuccauuuuauaaugcuacuuguuauaauuauuuacaggcguuuaaugcgucuagcgcugcaucuaguuaugcaguaucuuuaggagaaauaucgguugguuuucaagcuacaagugaugauauugcaucuauuguuaacaaaccuguuacuauuuauuauaguauuggagaugguaugcaauuuucucaguggguuggauaucaaccgaugaugauccuagaccagcuuccugcaccaguaguaagggccgugccugagggcccuauugcgaagauuaaaaacuucuuccaucaaacaaccgacgaaguuagagaagcucaggcagcaaagaugcgugaagauauggguaugguuguccaagauguuauuggagaaguuacccaggccauaccggaucuucaacaacuggagguucaaacaaaugucuuuucacuggugucuccguuagugcaugccguuauggguacuaguuugaagacgguugcuugggcgauuguuucgauuuuugugacuuuaggauuaauuggacgcgaaaugaugcauucaguuauuacuguagucaagcgguaacuugagaaauaucacuuggcgacgcaacccccggaauccgccagcucaaguacuguuauaucugccguuccaaaagcucccaaugcugaagcggaagaggcaagugcuuggguguccguuauuuauaauggcgcguguaauaugcuuaauguggcugcucaaaaaccgaaacaauuuaaagauuggguaaaauuagcuacgguggauuuuaguaauaauuguacagguaguaaccagguauuuguauuuuucaagaauucuuuugaaguguugaagaaaaugggggguuauguauuuugucagaguaauccugcagcgcguuuguugaaagcugagaaugacaagccugagauuuuaaaaucaugguugaaggaaugucucucuuuggaugaucacaauuugagauugcgucgagcgcaugaucaagaguauaucgagagaguguuugcggcacauucauauggacaaauuuugcuacaugauuuaacugcugaaaugaaucaaucacgaaauuugaguguguuuacacguguguaugaucaaauuucaaaauugaagacugaucuuauggaaaugggaucgaauccauauauaaggcgugaauguuuuacgauaugcauguguggugcaucuggaauuggaaaaucauauuugaccgauucuuuaugcagcgagcucuuacgugcgagucguacuccugugacaacaggcauaaaaugcguuguuaauccauuaucugauuauugggaucaaugcgauuuucagccuguuuugugcguugaugacauguggaguguugaaacaucuacuacgcucgauaagcaguugaauaugcuuuuccagguucauuccccuaucgugcuuucuccuccuaaagcugauuuagaagguaagaaaaugcgauauaacccggaaauauucauauacaauacgaauaaaccuuuuccgagguuugaucguauugcuauggaagcuauuuaucggcguagaaauguuuugauugaauguaaagcgagugaagagaagaagcgaggauguaagcauugugagaaugauauuccuauugcugaauguaguccuaagauguugaaagauuuucaucauauuaaauuuagguaugcacaugauguauguaauuccgagaccacauggucugaauggaugacguauaaugaauuucuugaauggauaacuccuguguauauggcuaaucgucguaaggcgaaugaaucguuuaagaugcguguggaugaaaugcaaauguuacguauggaugaaccauuggaaggugauaauauccucaauaaguauguugaaguuaaucagcgcuuaguggaggaaaugaaggcauuuaaggagcguacacuauggucagauuuacaucgcguaggugcggaaauuagugcgucaguuaagaaagcuuuaccaaccauuuccauaaccgaaaaacuaccacauuggacuguucaaugugguauugcuaaaccugagauggaccaugcuuaugagguuaugaguucguaugcagcuggaaugaaugcagagauugaagcgcaugaacaaguucggcuuucaucaguagaaugucaauaugcagagccucaagcuccaagaaacucugaugaugaaggaccaaccauagaugaagaacuuaugggcgacacugaauuuacaucacaggcucuagaacgucuuguggaugaagguuauauaacuggaaaacagaagaaauauauggcuaugugguguaguaagcgucgugaacauacugccgacuuugaucuuguguggacugauaauuugcguguguuaagugcguaugcgcaugaucgcucaucuucaacucggcuuucuacggaugaugucaaguuauauaaaacaauuagcauguuacaucaaaaguaugauacuacagagugugcuaaaugucaacauugguaugcuccguugacugacaucuauguugaugauaagaaauuguucuggugucagaaagagacaaagacacuuauugauguccgcaaauugucgaaagaagaugugacuguucaaucaaaauugauuaacuuaucuguuccuuguggugaaguguguauguuacauucaaaauauuucaauuaucuuuuccauaaagcaugguuguuugagaacccgacuuggcgccuaauauauaaugguaccaagaaggguaugccugaguacuuuaugaauuguguggaugaaauuucauuagauuccaaauuugguaaagugaaaguaugguugcaagcgauuauugacaaguauuuaacucgucccgugaaaaugauucgugauuuucuuuucaagugguggccgcaaguugcguauguguugagcuugcuagguauaauugguauaacugcguaugaaaugagaaauccgaaaccaacuucugaggaacuagcugaucauuaugugaauaggcauuguagcucagauuuuuggucaccaggacuggcaucaccucaaggauugaaauauagugaagcaguaacaguaaaggcgccaagaauccauagauugccaguuacuacuaagccucaaggaucaacacaacaaguagacgcugcugugaauaagauucuacagaacaugguuuauauugguguuguuuucccaaaagugccugguaguaaguggcgagauauuaauuuuaggugucuuaugcuucauaauaggcaauguuuaauguugaggcauuauauugagucaacugcugccuuuccugagggaaccaaguacuauuuuaaguauauucauaaucaagagacuagaaugucuggugauauuucugguauugaaauugauuuguugaauuuaccuagauuguauuaugguggucucgcgggagaggagucguuugauaguaauaucgugcuugugacuaugccuaaucguauuccugaguguaagagcauuauuaaauuuauagcgucacauaaugagcauauacgugcucagaaugauggaguguuaguaacuggcgaccauacucagcuauuggcuuucgagaauaauaauaaaacuccaauaaguaucaaugcugaugguuuguaugagguuauacuucaaggaguauauacuuauccauaccauggcgaugguguuugugguucgauauuguuaucucggaauuuacaacggccaauuauagguauccauguugcugguacugaaggauugcauggcuuuggaguugcugaaccacuuguacaugaaauguucacugguaaagcaaucgagagugaaagagagccguaugaucguguguaugaacuuccguugcgugaauuagaugaaucugauauugguuuagauaccgauuuauauccgauugguagaguggaugcaaagcuagcucaugcucaaagcccuucuacugggauuaaaaagacgcuuauccauggaacauuugauguaaggacugaaccaaacccgaugucaucacgugauccaagaauagcgccgcacgauccuuugaaguuagggugugaaaagcauggcaugcccuguucaccguuuaauaggaaacaucuggaauuagcgacaaaucauuugaaagaaaaauuaguuucaguaguuaaaccaauaaaugguugcaagauuagaaguuugcaagaugcuguauguggugugccuggauuagauggguuugauucgauaucuuggaauacuagugcugguuuuccuuuaucuucauuaaagccaccuggaacaucagguaagcgaugguuguuugacauugagcuacaagauucgggauguuaucuccugcguggaaugcgucccgaacuugagauucaauuaucaacgacacaguuaaugaggaaaaagggaauaaaaccucacacuauauucacggauuguuugaaagauacuuguuugccuguggaaaaauguagaauaccugguaagacuagaauauuuaguauaaguccgguacaguuuaccauaccguuucgacaguauuauuuagacuuuauggcauccuaucgagcugcacgacuuaaugcugagcaugguauugguauugauguuaacagcuuagaguggacaacuuuggcaacaagguugucuaaguauggcacucacaucgugacaggagacuauaagaauuuugguccuggguuagauuccgauguugcagcuucagcguucgaaauuauuaucgacuggguauuacauuacaccgaagaagauaauaaagacgaaaugaagcgaguaauguggaccauggcgcaagagaucuuagcgccuagucaucuauaucgugacuugguguaccgaguaccuugcggaauuccaucagguucuccaauaacggacauauugaauacaauuucaaauuguuuguuaauuagguuagcuugguuagguauuacugauuugccuuuguccgaguucucucaaaauguuguucuugucuguuauggcgaugaucuuaucaugaauguuagcgauaauaugauugauaaguuuaacgccgugacgauaggaaaauucuuuucacaauauaagauggaauuuacggaucaggauaaaucaggaaauacuguaaaguggcggacgucauggcuuuggaguugcugaaccacuuguacaugaaauguucaccgguaaagcaaucgagagugaaagagagccguaugaucguguguaugaacuuccguugcgugaauuagaugaaucugauauugguuuagauacugauuuauauccgauugguagaguggaugcaaagcuagcucaugcucaaagcccuucuacugggauuaaaaagacgcuuauccauggaacauuugauguaaggacugaaccaaauccgaugucaucacgugauccaagaauagcgccgcaugauccuuugaaguuagggugugaaaagcauggcaugccuuguucaccguuuaauaggaaacaucuggaauuagcgacaaaucauuugaaagaaaaauuaguuucaguaguuaaaccaauaaaugguugcaagauuagaaguuugcaagaugcuguauguggugugccugguuuagauggguuugauucgauaucuuggaauacuagugcugguuuuccuuugucuucauuaaagccaccuggaacaucagguaagcgaugguuguuugacauugagcuacaagacucgggauguuaucuccugcguggaaugcgucccgaacuugagauucaauuaucaacgacgcaguuaaugaggaaaaagggaauaaaaccucacacuauauucacggauuguuugaaagauacuuguuugccuguugaaaaauguagaauaccugguaagacuagaauauuuaguauaaguccuguacaguuuaccauaccguuucgacaguauuacuuagacuuuauggcauccuaucgagcugcacgacuuaaugcugagcaugguauugguauugauguuaacagcuuagaguggacaaauuuggcaacaaguuugucuaaguauggcacucacaucgugacaggagacuauaagaauuuugguccuggguuagauuccgauguugcagcuucagcguucgaaauuauuaucgacuggguauuacauuacaccgaagaagauaauaaagaugaaaugaagcgaguaauguggaccauggcgcaagagaucuuagcgccuagucaucuaugucgcgacuugguguaccgaguaccuuguggaauuccaucagguucuccaauaacggacauauugaauacaauuucaaauuguuuguuaauuagguuagcuugguuagguauuacugacuuaccuuuguccgaguucucucaaaauguuguucuugucuguuauggcgacgaucuuauuaugaauguuagcgauaauaugauugauaaguuuaaugccgugacgauaggaaaauucuuuucacaauauaagauggaauuuacggaucaggauaaaucaggaaauaccguaaaguggcggacguuacagacugcuacuuucuuaaaacauggguuuuuaaaacauccaacuagaccuguguuuuuagcuaaccuggauaaggucucgguagaaggaacgacgaauuggacucaugcucgaggauugggucgucguacagcaaccauagagaaugcuaaacaagcgcuagaguuagcauucggaugggguccagaauacuuuaacuaugucagaaauacuaucaaaauggcuuuugacaaguuggguauuuaugaagaccuuaucacuugggaggaaauggauguuagauguuaugcuagcgcguaguauuuaauuuugaauacucauuaguuuuaauuuuauuuuagguuauuggaauugagggaaguaccaccccccaagaccuucguuuuaaaucuacuaaaaggagugaaccuauauauaagagucuaaaaacagaguggauuagaccaccauuu

Brak komentarzy:

Prześlij komentarz